Searched 4,843 files and found 1618 matches in 6.54s.
| title | wikipedia_summary | wikipedia |
|---|---|---|
| Qalb | قلب (Levantine Arabic: [ʔalb]), transliterated Qalb, Qlb and Alb, is a functional programming language allowing a programmer to write programs completely in Arabic. Its name means heart and is a recursive acronym in Arabic meaning Qlb: a programming language (قلب: لغة برمجة, Qlb: Lughat Barmajah). It was developed in 2012 by Ramsey Nasser, a computer scientist at the Eyebeam Art + Technology Center in New York City, as both an artistic endeavor and as a response to the Anglophone bias in the vast majority of programming languages, which express their fundamental concepts using English words. The syntax is like that of Lisp or Scheme, consisting of parenthesized lists. All keywords are appropriate Arabic terms, and program text is laid out right-to-left, like all Arabic text. The language provides a minimal set of primitives for defining functions, conditionals, looping, list manipulation, and basic arithmetic expressions. It is Turing-complete, and the Fibonacci sequence and Conway's Game of Life have been implemented. Because all program text is written in Arabic, and the connecting strokes between characters in the Arabic script can be extended to any length, it is possible to align the source code in artistic patterns, in the tradition of Arabic calligraphy. A JavaScript-based interpreter is currently hosted on herokuapp and the project can be forked on GitHub. | https://en.wikipedia.org/wiki/Qalb_(programming_language) |
| ΜC++ | μC++, also called uC++, is a programming language, an extension of C++ designed for concurrent programming. Among other features, it adds coroutines, tasks, and monitors, and extends existing language constructs to integrate with them. Its compiler, named u++, operates as a source-to-source translator targeting C++. μC++ is part of the μSystem project, of the University of Waterloo, Ontario, Canada, a large-scale project led by professor Peter Buhr with the goal to create a "highly-concurrent shared-memory programming system".It is used in course CS 343 in University of Waterloo.Every μC++ program should include the uC++.h header file before any other header, although this is not necessary for more recent versions. uC++ is now open source, available on GitHub. | https://en.wikipedia-on-ipfs.org/wiki/%CE%9CC%2B%2B |
| ΛProlog | λProlog, also written lambda Prolog, is a logic programming language featuring polymorphic typing, modular programming, and higher-order programming. These extensions to Prolog are derived from the higher-order hereditary Harrop formulas used to justify the foundations of λProlog. Higher-order quantification, simply typed λ-terms, and higher-order unification gives λProlog the basic supports needed to capture the λ-tree syntax approach to higher-order abstract syntax, an approach to representing syntax that maps object-level bindings to programming language bindings. Programmers in λProlog need not deal with bound variable names: instead various declarative devices are available to deal with binder scopes and their instantiations. Since 1986, λProlog has received numerous implementations. As of 2013, the language and its implementations are still actively being developed. The Abella theorem prover has been designed to provide an interactive environment for proving theorems about the declarative core of λProlog. | https://en.wikipedia.org/wiki/%CE%9BProlog |
| xBase | xBase is the generic term for all programming languages that derive from the original dBASE (Ashton-Tate) programming language and database formats. These are sometimes informally known as dBASE "clones". While there was a non-commercial predecessor to the Ashton-Tate product (Vulcan written by Wayne Ratliff), most clones are based on Ashton-Tate's 1986 dBASE III+ release — scripts written in the dBASE III+ dialect are most likely to run on all the clones. | https://en.wikipedia.org/wiki/XBase |
| x86-64 | x86-64 (also known as x64, x86_64, AMD64 and Intel 64) is the 64-bit version of the x86 instruction set. It introduces two new modes of operation, 64-bit mode and compatibility mode, along with a new 4-level paging mode. With 64-bit mode and the new paging mode, it supports vastly larger amounts of virtual memory and physical memory than is possible on its 32-bit predecessors, allowing programs to store larger amounts of data in memory. x86-64 also expands general-purpose registers to 64-bit, as well extends the number of them from 8 (some of which had limited or fixed functionality, e.g. for stack management) to 16 (fully general), and provides numerous other enhancements. Floating point operations are supported via mandatory SSE2-like instructions, and x87/MMX style registers are generally not used (but still available even in 64-bit mode); instead, a set of 32 vector registers, 128 bits each, is used. (Each can store one or two double-precision numbers or one to four single precision numbers, or various integer formats.) In 64-bit mode, instructions are modified to support 64-bit operands and 64-bit addressing mode. The compatibility mode allows 16- and 32-bit user applications to run unmodified coexisting with 64-bit applications if the 64-bit operating system supports them. As the full x86 16-bit and 32-bit instruction sets remain implemented in hardware without any intervening emulation, these older executables can run with little or no performance penalty, while newer or modified applications can take advantage of new features of the processor design to achieve performance improvements. Also, a processor supporting x86-64 still powers on in real mode for full backward compatibility. The original specification, created by AMD and released in 2000, has been implemented by AMD, Intel and VIA. The AMD K8 processor was the first to implement it. This was the first significant addition to the x86 architecture designed by a company other than Intel. Intel was forced to follow suit and introduced a modified NetBurst family which was software-compatible with AMD's specification. VIA Technologies introduced x86-64 in their VIA Isaiah architecture, with the VIA Nano. The x86-64 architecture is distinct from the Intel Itanium architecture (formerly IA-64), which is not compatible on the native instruction set level with the x86 architecture. Operating systems and applications written for one cannot be run on the other. | https://en.wikipedia.org/wiki/x86-64 |
| X86 | x86 is a family of backward-compatible instruction set architectures based on the Intel 8086 CPU and its Intel 8088 variant. The 8086 was introduced in 1978 as a fully 16-bit extension of Intel's 8-bit-based 8080 microprocessor, with memory segmentation as a solution for addressing more memory than can be covered by a plain 16-bit address. The term "x86" came into being because the names of several successors to Intel's 8086 processor end in "86", including the 80186, 80286, 80386 and 80486 processors. Many additions and extensions have been added to the x86 instruction set over the years, almost consistently with full backward compatibility. The architecture has been implemented in processors from Intel, Cyrix, AMD, VIA and many other companies; there are also open implementations, such as the Zet SoC platform. Nevertheless, of those, only Intel, AMD, and VIA hold x86 architectural licenses, and are producing modern 64-bit designs.The term is not synonymous with IBM PC compatibility, as this implies a multitude of other computer hardware; embedded systems, as well as general-purpose computers, used x86 chips before the PC-compatible market started, some of them before the IBM PC (1981) itself. As of 2018, the majority of personal computers and laptops sold are based on the x86 architecture, while other categories—especially high-volume mobile categories such as smartphones or tablets—are dominated by ARM; at the high end, x86 continues to dominate compute-intensive workstation and cloud computing segments. | https://en.wikipedia.org/wiki/X86 |
| x86 Assembly | x86 assembly language is a family of backward-compatible assembly languages, which provide some level of compatibility all the way back to the Intel 8008 introduced in April 1972. x86 assembly languages are used to produce object code for the x86 class of processors. Like all assembly languages, it uses short mnemonics to represent the fundamental instructions that the CPU in a computer can understand and follow. Compilers sometimes produce assembly code as an intermediate step when translating a high level program into machine code. Regarded as a programming language, assembly coding is machine-specific and low level. Assembly languages are more typically used for detailed and time critical applications such as small real-time embedded systems or operating system kernels and device drivers. | https://en.wikipedia.org/wiki/X86_assembly_language |
| WxBasic | wxBasic is a free software / open-source software, cross-platform BASIC interpreter. As it is based on syntax of the BASIC language, it is designed to be simple to learn and understand, and allow novice programmers to write applications for graphical environments like Windows and Linux with minimal effort. wxBasic is a bytecode based language, like Perl or Java. It is licensed under the LGPL, so proprietary software's source code can be linked against it. It can create stand-alone executables by binding together source code with the interpreter. In contrast with executables created by similar commercial programs like Visual Basic, executables produced by wxBasic do not require any external DLL file, resource file, or installer to run. The executable is distributed alone and can be run immediately by end-users. As with programs written in any interpreted language, wxBasic programs may also be run straight from the source code on any platform, if wxBasic is present. wxBasic is written primarily in C, with some C++ linking it to the wxWidgets library. wxWidgets supplies the cross-platform features. It runs on Microsoft Windows using native controls, and on Linux and macOS using the GTK+ library. | https://en.wikipedia.org/wiki/WxBasic |
| Vvvv | vvvv (German pronunciation: [faʊfiːɐ̯ ] = "v4") is a general purpose toolkit with a special focus on real-time video synthesis and programming large media environments with physical interfaces, real-time motion graphics, audio and video. vvvv uses a dataflow approach and a visual programming interface for rapid prototyping and developing. Applications written in vvvv are commonly called patches. Patches consist of a network of nodes. Patches can be created, edited and tested while they are running. Patches are stored on the disk in standard XML format. vvvv is written in Borland Delphi, plugins can be developed in the .NET Framework in C#. Most nodes handle data in a one-dimensional array of values, called Spreads. In addition to traditional vector algebra this allows programming of particle systems, as also rendering nodes and deal with arrays of values accordingly. If an operation has to deal with arrays of different lengths, the shorter array gets repeated to fill up the larger. vvvv includes a feature it calls boygrouping, where one computer controls a number of slave computers to operate in parallel, with all programming and editing done on the master computer. The toolkit has the ability to work with HLSL Shaders which are written in their common textual form but are embedded in the data flow language and are instantly compiled and uploaded as soon any part of their source code is changed. With a focus on video synthesis and processing, vvvv uses the toolkit DirectX and, as such, is available for Microsoft Windows systems only, although it is known to run stably under Parallels and VMWare Fusion. vvvv currently supports DirectX 9 (including PS 3 and VS 3 shader techniques) and DirectX 11. vvvv was initially developed by the Frankfurt-based media collective MESO as an in-house tool for their own projects, but was then released. vvvv is now maintained by the VVVV group. vvvv is free for non-commercial use and available for download at its website. Any commercial uses require a license. | https://en.wikipedia.org/wiki/Vvvv |
| VlibTemplate | vlibTemplate is a template engine written in PHP. Programmers and web developers may use it for web development. vlibTemplate is a PHP class that is intended to make splitting PHP from HTML a simple and natural task, using markup tags. This class allows users to set values for variables, loops, if statements, etc. which are declared in the template. vlibTemplate is a part of vLIB. It has an interface to vlibDate and vlibMimeMail. | https://en.wikipedia.org/wiki/VlibTemplate |
| vi | vi is a screen-oriented text editor originally created for the Unix operating system. The portable subset of the behavior of vi and programs based on it, and the ex editor language supported within these programs, is described by (and thus standardized by) the Single Unix Specification and POSIX.The original code for vi was written by Bill Joy in 1976, as the visual mode for a line editor called ex that Joy had written with Chuck Haley. Bill Joy's ex 1.1 was released as part of the first Berkeley Software Distribution (BSD) Unix release in March 1978. It was not until version 2.0 of ex, released as part of Second BSD in May 1979 that the editor was installed under the name "vi" (which took users straight into ex's visual mode), and the name by which it is known today. Some current implementations of vi can trace their source code ancestry to Bill Joy; others are completely new, largely compatible reimplementations. The name "vi" is derived from the shortest unambiguous abbreviation for the ex command visual, which switches the ex line editor to visual mode. The name is sometimes pronounced (as in the discrete English letters v and i) and sometimes to rhyme with bye.In addition to various non–free software variants of vi distributed with proprietary implementations of Unix, vi was opensourced with OpenSolaris, and several free and open source software vi clones exist. A 2009 survey of Linux Journal readers found that vi was the most widely used text editor among respondents, beating gedit, the second most widely used editor, by nearly a factor of two (36% to 19%). | https://en.wikipedia.org/wiki/Vi |
| Urbiscript | urbiscript is a programming language for robotics. It features syntactic support for concurrency and event-based programming. It is a prototype-based object-oriented scripting language. It is dynamic: name resolution is performed during the program execution (late binding); slots (member variables) can be added/removed at runtime, and even prototypes (superclasses) of an object can be changed at runtime. Memory management is performed by reference counting. Tightly bound to the Urbi platform it supports seamless integration of C++/Java components. | https://en.wikipedia.org/wiki/Urbiscript |
| Txt2tags | txt2tags is a document generator software that uses a lightweight markup language. txt2tags is free software under GNU General Public License. Written in Python, it can export documents to several formats including: HTML, XHTML, SGML, LaTeX, Lout, roff, MediaWiki, Google Code Wiki, DokuWiki, MoinMoin, MagicPoint, PageMaker and plain text. | https://en.wikipedia.org/wiki/Txt2tags |
| Troff | troff is the major component of a document processing system developed by AT&T Corporation for the Unix operating system. troff features commands to designate fonts, spacing, paragraphs, margins, footnotes and more. Unlike many other text formatters, troff can position characters arbitrarily on a page, even overlapping them, and has a fully programmable input language. Separate preprocessors are used for more convenient production of tables, diagrams, and mathematics. Inputs to troff are plain text files that can be created by any text editor. Extensive macro packages have been created for various document styles. A typical distribution of troff includes the me macros for formatting research papers, man and mdoc macros for creating Unix man pages, mv macros for creating mountable transparencies, and the ms and mm macros for letters, books, technical memoranda, and reports. | https://en.wikipedia.org/wiki/Troff |
| ThinBasic | thinBasic is a BASIC-like computer programming language interpreter with a central core engine architecture surrounded by many specialized modules. Although originally designed mainly for computer automation, thanks to its modular structure it can be used for wide range of tasks. | https://en.wikipedia.org/wiki/ThinBasic |
| sed | sed (stream editor) is a Unix utility that parses and transforms text, using a simple, compact programming language. sed was developed from 1973 to 1974 by Lee E. McMahon of Bell Labs, and is available today for most operating systems. sed was based on the scripting features of the interactive editor ed ("editor", 1971) and the earlier qed ("quick editor", 1965–66). sed was one of the earliest tools to support regular expressions, and remains in use for text processing, most notably with the substitution command. Other options for doing "stream editing" include AWK and Perl. | https://en.wikipedia.org/wiki/Sed |
| Refer | refer is a program for managing bibliographic references, and citing them in troff documents. It is implemented as a troff preprocessor. refer was written by Mike Lesk at Bell Laboratories in or before 1978, and is now available as part of most Unix-like operating systems. A free reimplementation exists as part of the groff package. As of 2015, refer sees little use, primarily because troff itself is not used much for longer technical writing that might need software support for reference and citation management. As of 2016, some reference management software (for instance, RefWorks) will import refer data. | https://en.wikipedia.org/wiki/Refer_(software) |
| Recfiles | recfiles is a file format for human-editable, plain text databases. Databases using this file format can be edited using any text editor. recfiles allow for basic relational database operations, typing, auto-incrementing, as well as a simple join operation. Recutils is a collection of tools, like recfmt, recsel, and rec2csv used to work with recfile databases. Various software libraries support the format. | https://en.wikipedia.org/wiki/Recfiles |
| reStructuredText | reStructuredText (sometimes abbreviated as RST, ReST, or reST) is a file format for textual data used primarily in the Python programming language community for technical documentation. It is part of the Docutils project of the Python Doc-SIG (Documentation Special Interest Group), aimed at creating a set of tools for Python similar to Javadoc for Java or POD for Perl. Docutils can extract comments and information from Python programs, and format them into various forms of program documentation. In this sense, reStructuredText is a lightweight markup language designed to be both (a) processable by documentation-processing software such as Docutils, and (b) easily readable by human programmers who are reading and writing Python source code. | https://en.wikipedia.org/wiki/ReStructuredText |
| Rc | rc (for "run commands") is the command line interpreter for Version 10 Unix and Plan 9 from Bell Labs operating systems. It resembles the Bourne shell, but its syntax is somewhat simpler. It was created by Tom Duff, who is better known for an unusual C programming language construct ("Duff's device"). A port of the original rc to Unix is part of Plan 9 from User Space. A rewrite of rc for Unix-like operating systems by Byron Rakitzis is also available but includes some incompatible changes. Rc uses C-like control structures instead of ALGOL-like, as the original Bourne shell, except that it uses an if not construct instead of else and has a Bourne-like for loop to iterate over lists. In rc all variables are lists of strings, which eliminates the need for constructs like "$@". | https://en.wikipedia.org/wiki/Rc |
| QMake | qmake is an utility that automates the generation of makefiles. Makefiles are used by the program make to build executable programs from source code; therefore qmake is a make-makefile tool, or makemake for short. The makefiles that qmake produces are tailored to the particular platform where it is run from based on qmake project files. This way one set of build instructions can be used to create build instructions on different operating systems. qmake supports code generation for the following operating systems: Linux, Apple Mac OS X, Symbian, Microsoft Windows and Microsoft Windows CE. qmake was created by Trolltech (now The Qt Company). It is distributed and integrated with the Qt application framework, and automates the creation of moc (meta object compiler) and rcc (resource compiler) sources, which are used in Qt's meta-object system and in the integration of binary resources (e.g., pictures). The qmake tool helps simplify the build process for development projects across different platforms. It automates the generation of Makefiles so that only a few lines of information are needed to create each Makefile. You can use qmake for any software project, whether it is written with Qt or not. | https://en.wikipedia.org/wiki/Qmake |
| Occam | occam is a concurrent programming language that builds on the communicating sequential processes (CSP) process algebra, and shares many of its features. It is named after William of Ockham of Occam's Razor fame. occam is an imperative procedural language (such as Pascal). It was developed by David May and others at INMOS, advised by Tony Hoare, as the native programming language for their transputer microprocessors, but implementations for other platforms are available. The most widely known version is occam 2; its programming manual was written by Steven Ericsson-Zenith and others at INMOS. | https://en.wikipedia.org/wiki/Occam_(programming_language) |
| ObjDump | objdump is a program for displaying various information about object files on Unix-like systems. For instance, it can be used as a disassembler to view an executable in assembly form. It is part of the GNU Binutils for fine-grained control over executables and other binary data. For example, $ objdump -D -M intel file.bin | grep main.: -A20 This performs disassembly on the file «file.bin», with the assembly code shown in Intel syntax. We then redirect it to grep, which searches the main function and displays 20 lines of its code. Example output: objdump uses the BFD library to read the contents of object files. Similar utilities are Borland TDUMP, Microsoft DUMPBIN and readelf. | https://en.wikipedia.org/wiki/objdump |
| o:XML | o:XML is an open source, dynamically typed, general-purpose object-oriented programming language based on XML-syntax. It has threads, exception handling, regular expressions and namespaces. Additionally o:XML has an expression language very similar to XPath that allows functions to be invoked on nodes and node sets. | https://en.wikipedia.org/wiki/O:XML |
| npm | npm is a package manager for the JavaScript programming language. It is the default package manager for the JavaScript runtime environment Node.js. It consists of a command line client, also called npm, and an online database of public and paid-for private packages, called the npm registry. The registry is accessed via the client, and the available packages can be browsed and searched via the npm website. The package manager and the registry are managed by npm, Inc. | https://en.wikipedia.org/wiki/Npm_(software) |
| NL | nl is a file format for presenting and archiving mathematical programming problems. Initially this format has been invented for connecting solvers to AMPL. It has also been adopted by other systems such as COIN-OR (as one of the input formats), FortSP (for interacting with external solvers), and Coopr (as one of its output formats). The nl format supports a wide range of problem types, among them: Linear programming Quadratic programming Nonlinear programming Mixed-integer programming Mixed-integer quadratic programming with or without convex quadratic constraints Mixed-integer nonlinear programming Second-order cone programming Global optimization Semidefinite programming problems with bilinear matrix inequalities Complementarity problems (MPECs) in discrete or continuous variables Constraint programmingThe nl format is low-level and is designed for compactness, not for readability. It has both binary and textual representation. Most commercial and academic solvers accept this format either directly or through special driver programs. The open-source AMPL Solver Library (ASL) distributed via Netlib and AMPL/MP library provide nl parsers that are used in many solvers. | https://en.wikipedia.org/wiki/Nl_(format) |
| NewLisp | newLISP is an open source scripting language in the Lisp family of programming languages developed by Lutz Mueller and released under the GNU General Public License. | https://en.wikipedia.org/wiki/NewLISP |
| nesC | nesC (pronounced "NES-see") is a component-based, event-driven programming language used to build applications for the TinyOS platform. TinyOS is an operating environment designed to run on embedded devices used in distributed wireless sensor networks. nesC is built as an extension to the C programming language with components "wired" together to run applications on TinyOS. The name nesC is an abbreviation of "network embedded systems C". | https://en.wikipedia.org/wiki/NesC |
| muMath | muMATH is a computer algebra system (CAS), which was developed in the late 1970s and early eighties by Albert D. Rich and David Stoutemyer of Soft Warehouse in Honolulu, Hawaii. It was implemented in the muSIMP programming language which was built on top of a LISP dialect called muLISP. Platforms supported were CP/M and TRS-DOS (since muMATH-79), Apple II (since muMATH-80) and DOS (in muMATH-83, the last version, which was published by Microsoft). The Soft Warehouse later developed Derive, another computer algebra system. The company was purchased by Texas Instruments in 1999, and development of Derive ended in 2006. | https://en.wikipedia.org/wiki/MuMATH |
| Matplotlib | matplotlib is a plotting library for the Python programming language and its numerical mathematics extension NumPy. It provides an object-oriented API for embedding plots into applications using general-purpose GUI toolkits like Tkinter, wxPython, Qt, or GTK+. There is also a procedural "pylab" interface based on a state machine (like OpenGL), designed to closely resemble that of MATLAB, though its use is discouraged. SciPy makes use of matplotlib. matplotlib was originally written by John D. Hunter, has an active development community, and is distributed under a BSD-style license. Michael Droettboom was nominated as matplotlib's lead developer shortly before John Hunter's death in 2012. As of 23 June 2017, matplotlib 2.0.x supports Python versions 2.7 through 3.6. Matplotlib 1.2 is the first version of matplotlib to support Python 3.x. Matplotlib 1.4 is the last version of matplotlib to support Python 2.6. | https://en.wikipedia.org/wiki/Matplotlib |
| MLAB | mLab is a fully managed cloud database service that hosts MongoDB databases. mLab runs on cloud providers Amazon, Google, and Microsoft Azure, and has partnered with platform-as-a-service providers. In May 2011, mLab secured $3 million in first-round funding from Foundry Group, Baseline Ventures, Upfront Ventures, Freestyle Capital and David Cohen.In October 2012, mLab received a follow-on investment of $5 million and shortly thereafter, mLab was named by Network World as one of the 10 most useful cloud databases along with Amazon Web Services, Google Cloud SQL, Microsoft Azure, Rackspace, and others. In June 2014, MongoDB Inc. announced a fully managed highly available MongoDB-as-a-Service Add-On offering on the Microsoft Azure store. The offering is delivered in collaboration with Microsoft and mLab.In February 2016, mLab changed its name from MongoLab to mLab to expand into new areas and products.In October 2018, mLab announced that it will be acquired by MongoDB Inc., citing reasons of a shared vision and engineering culture. All engineers at mLab have been invited to join MongoDB Inc. All of mLab's customers will be transitioned to MongoDB Atlas instances.. The acquisition "is expected to close in the fourth quarter of MongoDB’s fiscal year ending Jan. 31, 2019". | https://en.wikipedia.org/wiki/MLab |
| M4 | m4 is a general-purpose macro processor included in all UNIX-like operating systems, and is a component of the POSIX standard. The language was designed by Brian Kernighan and Dennis Ritchie for the original versions of UNIX. It is an extension of an earlier macro processor m3, written by Ritchie for the AP-3 minicomputer. The macro preprocessor operates as a text-replacement tool. It is employed to re-use text templates, typically in computer programming applications, but also in text editing and text-processing applications. Most users require m4 as a dependency of GNU autoconf. | https://en.wikipedia.org/wiki/M4_(computer_language) |
| Knitr | knitr is an engine for dynamic report generation with R. It is a package in the statistical programming language R that enables integration of R code into LaTeX, LyX, HTML, Markdown, AsciiDoc, and reStructuredText documents. The purpose of knitr is to allow reproducible research in R through the means of Literate Programming. It is licensed under the GNU General Public License.knitr was inspired by Sweave and written with a different design for better modularization, so it is easier to maintain and extend. Sweave can be regarded as a subset of knitr in the sense that all features of Sweave are also available in knitr. Some of knitr's extensions include the R Markdown format (used in reports published on RPubs), caching, TikZ graphics and support to other languages such as Python, Perl, C++, Shell scripts and CoffeeScript, and so on. knitr is officially supported in the RStudio IDE for R, LyX, Emacs/ESS and the Architect IDE for data science. | https://en.wikipedia.org/wiki/Knitr |
| JQuery | jQuery is a cross-platform JavaScript library designed to simplify the client-side scripting of HTML. It is free, open-source software using the permissive MIT License. Web analysis indicates that it is the most widely deployed JavaScript library by a large margin. jQuery's syntax is designed to make it easier to navigate a document, select DOM elements, create animations, handle events, and develop Ajax applications. jQuery also provides capabilities for developers to create plug-ins on top of the JavaScript library. This enables developers to create abstractions for low-level interaction and animation, advanced effects and high-level, themeable widgets. The modular approach to the jQuery library allows the creation of powerful dynamic web pages and Web applications. The set of jQuery core features—DOM element selections, traversal and manipulation—enabled by its selector engine (named "Sizzle" from v1.3), created a new "programming style", fusing algorithms and DOM data structures. This style influenced the architecture of other JavaScript frameworks like YUI v3 and Dojo, later stimulating the creation of the standard Selectors API. Microsoft and Nokia bundle jQuery on their platforms. Microsoft includes it with Visual Studio for use within Microsoft's ASP.NET AJAX and ASP.NET MVC frameworks while Nokia has integrated it into the Web Run-Time widget development platform. | https://en.wikipedia.org/wiki/JQuery |
| mawk | is a very fast AWK implementation by Mike Brennan based on a bytecode interpreter. | https://en.wikipedia.org/wiki/AWK#Versions_and_implementations |
| iOS | iOS (formerly iPhone OS) is a mobile operating system created and developed by Apple Inc. exclusively for its hardware. It is the operating system that presently powers many of the company's mobile devices, including the iPhone, iPad, and iPod Touch. It is the second most popular mobile operating system globally after Android. Originally unveiled in 2007 for the iPhone, iOS has been extended to support other Apple devices such as the iPod Touch (September 2007) and the iPad (January 2010). As of March 2018, Apple's App Store contains more than 2.1 million iOS applications, 1 million of which are native for iPads. These mobile apps have collectively been downloaded more than 130 billion times. The iOS user interface is based upon direct manipulation, using multi-touch gestures. Interface control elements consist of sliders, switches, and buttons. Interaction with the OS includes gestures such as swipe, tap, pinch, and reverse pinch, all of which have specific definitions within the context of the iOS operating system and its multi-touch interface. Internal accelerometers are used by some applications to respond to shaking the device (one common result is the undo command) or rotating it in three dimensions (one common result is switching between portrait and landscape mode). Apple has been significantly praised for incorporating thorough accessibility functions into iOS, enabling users with vision and hearing disabilities to properly use its products. Major versions of iOS are released annually. The current version, iOS 12, was released on September 17, 2018. It is available for all iOS devices with 64-bit processors; the iPhone 5S and later iPhone models, the iPad (2017), the iPad Air and later iPad Air models, all iPad Pro models, the iPad Mini 2 and later iPad Mini models, and the sixth-generation iPod Touch. On all recent iOS devices, the iOS regularly checks on the availability of an update, and if one is available, will prompt the user to permit its automatic installation. | https://en.wikipedia.org/wiki/IOS |
| Gzip | gzip is a file format and a software application used for file compression and decompression. The program was created by Jean-loup Gailly and Mark Adler as a free software replacement for the compress program used in early Unix systems, and intended for use by GNU (the "g" is from "GNU"). Version 0.1 was first publicly released on 31 October 1992, and version 1.0 followed in February 1993. | https://en.wikipedia.org/wiki/Gzip |
| grep | grep is a command-line utility for searching plain-text data sets for lines that match a regular expression. Its name comes from the ed command g/re/p (globally search a regular expression and print), which has the same effect: doing a global search with the regular expression and printing all matching lines. Grep was originally developed for the Unix operating system, but later available for all Unix-like systems. | https://en.wikipedia.org/wiki/Grep |
| Gnuplot | gnuplot is a command-line program that can generate two- and three-dimensional plots of functions, data, and data fits. It is frequently used for publication-quality graphics as well as in education. The program runs on all major computers and operating systems (Linux, Unix, Microsoft Windows, macOS, and others). It is a program with a fairly long history, dating back to 1986. Despite its name, this software is not part of the GNU project. | https://en.wikipedia.org/wiki/Gnuplot |
| Ext3 | ext3, or third extended filesystem, is a journaled file system that is commonly used by the Linux kernel. It used to be the default file system for many popular Linux distributions. Stephen Tweedie first revealed that he was working on extending ext2 in Journaling the Linux ext2fs Filesystem in a 1998 paper, and later in a February 1999 kernel mailing list posting. The filesystem was merged with the mainline Linux kernel in November 2001 from 2.4.15 onward. Its main advantage over ext2 is journaling, which improves reliability and eliminates the need to check the file system after an unclean shutdown. Its successor is ext4. | https://en.wikipedia.org/wiki/Ext3 |
| ExFAT | exFAT (Extended File Allocation Table) is a Microsoft file system introduced in 2006 and optimized for flash memory such as USB flash drives and SD cards. It is proprietary and Microsoft owns patents on several elements of its design.exFAT can be used where NTFS is not a feasible solution (due to data-structure overhead), but a greater file-size limit than the standard FAT32 file system (i.e. 4 GiB) is required. exFAT has been adopted by the SD Card Association as the default file system for SDXC cards larger than 32 GiB. | https://en.wikipedia.org/wiki/ExFAT |
| XHTML | eXtensible HyperText Markup Language (XHTML) is part of the family of XML markup languages. It mirrors or extends versions of the widely used HyperText Markup Language (HTML), the language in which Web pages are formulated. While HTML, prior to HTML5, was defined as an application of Standard Generalized Markup Language (SGML), a flexible markup language framework, XHTML is an application of XML, a more restrictive subset of SGML. XHTML documents are well-formed and may therefore be parsed using standard XML parsers, unlike HTML, which requires a lenient HTML-specific parser.XHTML 1.0 became a World Wide Web Consortium (W3C) recommendation on January 26, 2000. XHTML 1.1 became a W3C recommendation on May 31, 2001. The standard known as XHTML5 is being developed as an XML adaptation of the HTML5 specification. | https://en.wikipedia.org/wiki/XHTML |
| ERB | eRuby (Embedded Ruby) is a templating system that embeds Ruby into a text document. It is often used to embed Ruby code in an HTML document, similar to ASP, JSP and PHP. The templating system of eRuby combines the ruby code and the plain text to provide flow control and variable substitution, thus making it easy to maintain.The View module of the rails is responsible to display the response or output on a browser. In its simplest form, a view can be a piece of HTML code which has some static content. For most applications, just having static content may not be enough. Many Rails applications will require dynamic content created by the controller (action method) to be displayed in their view. This is made possible by using Embedded Ruby to generate templates which can contain dynamic content. Embedded Ruby allows ruby code to be embedded in a view document. This code gets replaced with proper value resulted from the execution of the code at run time. But, by having the ability to embed code in a view document, we risk bridging the clear separation present in the MVC frame. It is thus the responsibility of the developer to make sure that there is a clear separation of responsibility among the model, view and controller modules of his/her application. | https://en.wikipedia.org/wiki/ERuby |
| eC | eC (Ecere C) is an object-oriented programming language, defined as a super-set of the C language. eC was initially developed as part of the Ecere Cross-platform Software Development Kit project. The goals of the language are to provide object-oriented constructs, reflection, properties and dynamic modules on top of the C language while maintaining C compatibility and optimal native performance.eC currently relies on GCC or Clang to perform the final steps of compilation, using C as an intermediate language. There are, however, plans to integrate directly with LLVM to skip the intermediate C files.eC is available as part of the ecere-sdk package in Debian/Ubuntu and other derived Linux distributions. A Windows installer also bundling MinGW-w64 is available from the main website. The free and open-source SDK including the eC compiler can also be built for a number of other platforms, including OS X, FreeBSD and Android.It is also possible to deploy eC applications to the web by compiling them to JavaScript through Emscripten, or to WebAssembly through Binaryen. | https://en.wikipedia.org/wiki/EC_(programming_language) |
| Deb file format | deb is the format, as well as extension of the software package format for the Linux distribution Debian and its derivatives. | https://en.wikipedia.org/wiki/Deb_(file_format) |
| Dc | dc (desk calculator) is a cross-platform reverse-polish calculator which supports arbitrary-precision arithmetic. It is one of the oldest Unix utilities, predating even the invention of the C programming language. Like other utilities of that vintage, it has a powerful set of features but terse syntax. Traditionally, the bc calculator program (with infix notation) was implemented on top of dc. This article provides some examples in an attempt to give a general flavour of the language; for a complete list of commands and syntax, one should consult the man page for one's specific implementation. | https://en.wikipedia.org/wiki/Dc_(computer_program) |
| DBase | dBase (also stylized dBASE) was one of the first database management systems for microcomputers, and the most successful in its day. The dBase system includes the core database engine, a query system, a forms engine, and a programming language that ties all of these components together. dBase's underlying file format, the .dbf file, is widely used in applications needing a simple format to store structured data. dBase was originally published by Ashton-Tate for microcomputer operating system CP/M in 1980, and later ported to Apple II and IBM PC computers running DOS. On the PC platform, in particular, dBase became one of the best-selling software titles for a number of years. A major upgrade was released as dBase III, and ported to a wider variety of platforms, adding UNIX, and VMS. By the mid-1980s, Ashton-Tate was one of the "big three" software publishers in the early business software market, the others being Lotus Development and WordPerfect. Starting in the mid-1980s, several companies produced their own variations on the dBase product and especially the dBase programming language. These included FoxBASE+ (later renamed FoxPro), Clipper, and other so-called xBase products. Many of these were technically stronger than dBase, but could not push it aside in the market. This changed with the disastrous introduction of dBase IV, whose design and stability were so poor that many users switched to other products. At the same time, there was growing use of IBM-invented SQL (Structured Query Language) in database products. Another factor was user adoption of Microsoft Windows on desktop computers. The shift toward SQL and Windows put pressure on the makers of xBase products to invest in major redesign to provide new capabilities. In spite of growing pressure to evolve, in the early 1990s xBase products constituted the leading database platform for implementing business applications. The size and impact of the xBase market did not go unnoticed, and within one year, the three top xBase firms were acquired by larger software companies. Borland purchased Ashton-Tate, Microsoft bought Fox Software, and Computer Associates acquired Nantucket. However, by the following decade most of the original xBase products had faded from prominence and several disappeared. Products known as dBase still exist, owned by dBase LLC. | https://en.wikipedia.org/wiki/DBase |
| ColorForth | colorForth is a programming language from the Forth language's original designer, Charles H. Moore, developed in the 1990s. There was an earlier predecessor called 386 OK which appeared for sale at Silicon Valley Forth Interest Group (SVFIG) meetings in 1992.An idiosyncratic programming environment, the colors simplify Forth's semantics, speed compiling, and are said to aid Moore's own poor eyesight: colorForth uses different colors in its source code (replacing some of the punctuation in standard Forth) to determine how different words are treated. colorForth was originally developed as the scripting language for Moore's own homebrew VLSI CAD program OKAD, with which he develops custom Forth processors. As the language gained utility, he rewrote his CAD program in it, spruced up the environment, and released it to the public. It has since gained a small following, spurred much debate in the Forth community, and sprung offshoots for other processors and operating environments. The language's roots are closer to the Forth machine languages Moore develops for his processors than to the mainstream standardized Forths in more widespread use. The language comes with its own tiny (63K) operating system. Practically everything is stored as source code and compiled as and when needed. The current colorForth environment is limited to running on Pentium grade PCs with limited support for lowest-common-denominator motherboards, AGP video, disk, and network hardware. Coloring in colorForth has semantic meaning. Red words start a definition and green words are compiled into the current definition. Thus, colorForth would be rendered in standard Forth as: : color forth ; Moore developed Forth in the early 1970s and created a series of implementations of the language. In the 1980s he diverged from (or rather ignored) the standardization of the language, instead continuing to evolve it. He developed a series of Forth-like languages, each fairly extreme in its simplicity: Machine Forth, OK, colorForth. There is some controversy about colorForth marginalizing color blind programmers, but Moore has stated that color is only one option for displaying the language. One of Moore's papers on colorForth was printed in black and white, but used italics and other typographical conventions to present source code. | https://en.wikipedia.org/wiki/ColorForth |
| Chomski | chomski virtual machine (named after the noted linguist Noam Chomsky) and pp (the pattern parser) refer to both a command line computer language and utility (interpreter for that language) which can be used to parse and transform text patterns. The utility reads input files character by character (sequentially), applying the operation which has been specified via the command line or a pp script, and then outputs the line. It was developed from 2006 as a Unix and Windows utility, and is available today for Windows and Linux systems. Pp has derived a number of ideas and syntax elements from Sed, a command line text stream editor. | https://en.wikipedia.org/wiki/Chomski |
| basic calculator | bc, for basic calculator (often referred to as bench calculator), is "an arbitrary-precision calculator language" with syntax similar to the C programming language. bc is typically used as either a mathematical scripting language or as an interactive mathematical shell. A typical interactive usage is typing the command bc on a Unix command prompt and entering a mathematical expression, such as (1 + 3) * 2, whereupon 8 will be output. While bc can work with arbitrary precision, it actually defaults to zero digits after the decimal point, so the expression 2/3 yields 0. This can surprise new bc users unaware of this fact. The -l option to bc sets the default scale (digits after the decimal point) to 20 and adds several additional mathematical functions to the language. bc first appeared in Version 6 Unix in 1975 and was written by Robert Morris and Lorinda Cherry of Bell Labs. bc was preceded by dc, an earlier arbitrary-precision calculator written by the same authors. dc could do arbitrary-precision calculations, but its reverse Polish notation (RPN) syntax was inconvenient for users, and therefore bc was written as a front-end to dc. bc was a very simple compiler (a single yacc source file with a few hundred lines), which converted the new, C-like, bc syntax into dc's postfix notation and piped the results through dc. In 1991, POSIX rigorously defined and standardized bc. Two implementations of this standard survive today: The first is the traditional Unix implementation, a front-end to dc, which survives in Unix and Plan 9 systems. The second is the free software GNU bc, first released in 1991 by Philip A. Nelson. The GNU implementation has numerous extensions beyond the POSIX standard and is no longer a front-end to dc (it is a bytecode interpreter). | https://en.wikipedia.org/wiki/Bc_(programming_language) |
| Asm.js | asm.js is an intermediate programming language designed to allow computer software written in languages such as C to be run as web applications while maintaining performance characteristics considerably better than standard JavaScript, the typical language used for such applications. asm.js consists of a strict subset of JavaScript, into which code written in statically-typed languages with manual memory management (such as C) is translated by a source-to-source compiler such as Emscripten (based on LLVM). Performance is improved by limiting language features to those amenable to ahead-of-time optimization and other performance improvements. Mozilla Firefox was the first web browser to implement asm.js-specific optimizations, starting with version 22. | https://en.wikipedia.org/wiki/Asm.js |
| algobox | algobox is an easy-to-use pedagogical software for initiation to algorithms, distributed under the GNU/GPL license. It is available for free for Linux, macOS and Windows platforms and can even run on a simple USB key. Using an algorithmic language in French and a simple and ergonomic graphical user interface, this software makes it easy to design and test algorithms that may be encountered in secondary school mathematics education. | https://fr.wikipedia.org/wiki/Algobox |
| alfred | alfred is an application launcher and productivity application for macOS. Alfred is free, though an optional paid upgrade ('Powerpack') is available. Using a keyboard shortcut chosen by the user, Alfred provides a quick way to find and launch applications and files on the Mac or to search the web both with predefined keywords for often-used sites such as Amazon.com, IMDb, Wikipedia and many others, with the ability to add users' custom searches for the sites most applicable to them. | https://en.wikipedia.org/wiki/Alfred_(software) |
| Zope | Zope is a family of free and open-source web application servers written in Python, and their associated online community. Zope stands for "Z Object Publishing Environment", and was the first system using the now common object publishing methodology for the Web. Zope has been recognized as a Python killer app, an application that helped put Python in the spotlight.Over the last few years, the Zope community has spawned several additional web frameworks with disparate aims and principles, but sharing philosophy, people, and source code. Zope 2 is still the most widespread of these frameworks, largely thanks to the Plone content management system, which runs on Zope 2. BlueBream (earlier called Zope 3) is less widespread but underlies several large sites, including Launchpad. Grok was started as a more programmer-friendly framework, "Zope 3 for cavemen", and in 2009 Pyramid (ex BFG) gained popularity in the Zope community as a minimalistic framework based on Zope principles. | https://en.wikipedia.org/wiki/Zope |
| Zonnon | Zonnon is a programming language along the Oberon, Modula, and Pascal language line. Jürg Gutknecht is the author of the programming language.Zonnon is a general purpose programming language in the Pascal, Modula-2 and Oberon family. Its conceptual model is based on objects, definitions, implementations and modules. Its computing model is concurrent, based on active objects which interact via syntax controlled dialogs. The language is being developed at ETH Zürich Institute for Computer Systems by Prof. Jürg Gutknecht. Zonnon introduces the concept of 'active objects' which are used to represent real world concurrent objects within computer programs. The Zonnon Language Report was written by Brian Kirk (director at Robinsons Associates), and David Lightfoot (Oxford Brookes University) working with Prof. Jürg Gutknecht (ETH, Zürich) and Dr. Eugene Zueff (Евгений Зуев) (Moscow State University). The first book about Zonnon was published by the N. I. Lobachevsky State University of Nizhny Novgorod (a.k.a. the Nizhni Novgorod State University). | https://en.wikipedia.org/wiki/Zonnon |
| ZigZag | ZigZag is Ted Nelson's trademark on a data model he has designed for computer interaction, both for users and between programs. Nelson's stated goal is on one hand a platform for the Project Xanadu hypertext and on the other a complete computing system built on new conventions. The design is centered on an information structure called a zzstructure and its interactive visualizations. Instead of conventional linear text or tree structures, zzstructure is a multidimensional extension of a spreadsheet whose cells can contain various kinds of data. At any moment, the display shows any two dimensions in table form much like a modern spreadsheet. Users can pivot the display about any cell to efficiently "rotate" any unseen dimension in place of either visible one, allowing them to browse high dimensional grids in a zigzag manner. | https://en.wikipedia.org/wiki/ZigZag_(software) |
| ZENO | Zeno (after pre-Socratic Greek philosopher Zeno of Elea) is an imperative procedural programming language designed to be easy to learn and user friendly. Zeno is generic in the sense that it contains most of the essential elements used in other languages to develop real applications. The Zeno Interpreter was designed for use in Windows 95 and later Microsoft operating systems. The interpreter comes with built-in debugging tools, a source code text editor, and an on-line language reference. Zeno was created by Stephen R. Schmitt and is maintained by Abecedarical Systems. | https://en.wikipedia.org/wiki/Zeno_(programming_language) |
| ZOPL | ZOPL is a programming language created by Geac Computer Corporation in the early 1970s for use on their mainframe computer systems used in libraries and banking institutions. It had similarities to C and Pascal. ZOPL stood for "Version Z, Our Programming Language". ZOPL is still in use at CGI Group (formerly known as RealTime Datapro), who ported it to VAX/VMS and Unix in the 1980s, and to Windows in 1998. It currently (2010) runs on Windows XP/2000/2003 and Red Hat Linux. The RTM (formerly ZUG) language compiler and runtime framework are written in ZOPL. Outside of CGI, ZOPL has not been in general use since the late 1980s, although there is still one known working system where it is found embedded in programs written in the KARL programming language. | https://en.wikipedia.org/wiki/ZOPL |
| Zip file format | ZIP is an archive file format that supports lossless data compression. A ZIP file may contain one or more files or directories that may have been compressed. The ZIP file format permits a number of compression algorithms, though DEFLATE is the most common. This format was originally created in 1989 and was first implemented in PKWARE, Inc.'s PKZIP utility, as a replacement for the previous ARC compression format by Thom Henderson. The ZIP format was then quickly supported by many software utilities other than PKZIP. Microsoft has included built-in ZIP support (under the name "compressed folders") in versions of Microsoft Windows since 1998. Apple has included built-in ZIP support in Mac OS X 10.3 (via BOMArchiveHelper, now Archive Utility) and later. Most free operating systems have built in support for ZIP in similar manners to Windows and Mac OS X. ZIP files generally use the file extensions .zip or .ZIP and the MIME media type application/zip. ZIP is used as a base file format by many programs, usually under a different name. When navigating a file system via a user interface, graphical icons representing ZIP files often appear as a document or other object prominently featuring a zipper. | https://en.wikipedia.org/wiki/Zip_(file_format) |
| ZBasic | ZBasic is a compiler which was first released by Simutek (Tucson, Arizona) in 1980. The combined efforts of Andrew Gariepy, Scott Terry, David Overton, Greg Branche, and Halbert Laing led to versions for MS-DOS, Apple II, Macintosh, CP/M, and TRS-80 computers. ZBasic is a very fast, efficient and quite advanced BASIC compiler with an integrated development environment. It aims to be used as a cross-platform development system, where the same source code can be compiled to different platforms without any modifications. ZBasic features device independent graphics: the same compiled code can work on different display resolutions and colors, and even in text mode. Original PC versions include graphical support up to EGA for MS-DOS. A special feature of ZBasic is BCD (binary coded decimal) math with accuracy up to 54 digits. Another special feature is INDEX$ array, an array of variable length strings that could be easily sorted, searched etc. In 1991, Harry Gish and 32 Bit Software Inc. of Dallas, Texas purchased the MS-DOS version. Nando Favaro expanded it to include 16- and 32-bit-specific machine code as well as VGA and VESA video. Zedcor concentrated on the Apple Macintosh market and renamed it FutureBASIC. | https://en.wikipedia.org/wiki/ZBasic |
| Z++ | Z++ is also a version of the C++ programming language (not to be confused with Z++ that this article is about).Z++ (pronounced zee plus plus) was an object-oriented extension to the Z specification language. Z++ is an object-oriented extension to the Z specification language, allowing for the definition of classes, and the relation of classes through inheritance, association or aggregation. The primary construct of Z++ is a class. A Z++ class consists of a number of clauses which are optional. Z++ Class Structure: CLASS ClassName [OWNS List_of_attributes] [FUNCTIONS constant_definitions] [TYPE type_declaration] [ENTENDS list_of_super_classes] [OPERATIONS list_of_state_change_operations_definitions] [RETURNS list_of_query_operations_definitions] [ACTIONS all_operations_declarations] [INVARIANT predicates] [HISTORY RTL_predicates] END CLASS | https://en.wikipedia.org/wiki/Z%2B%2B |
| ARITH-MATIC | You may have been looking for arithmetic, a branch of mathematics.ARITH-MATIC is an extension of Grace Hopper's A-2 programming language, developed around 1955. ARITH-MATIC was originally known as A-3, but was renamed by the marketing department of Remington Rand UNIVAC. | https://en.wikipedia.org/wiki/ARITH-MATIC |
| Yorick | Yorick is an interpreted programming language designed for numerics, graph plotting, and steering large scientific simulation codes. It is quite fast due to array syntax, and extensible via C or Fortran routines. It was created in 1996 by David H. Munro of Lawrence Livermore National Laboratory. | https://en.wikipedia.org/wiki/Yorick_(programming_language) |
| Yes It Is | Yii is an open source, object-oriented, component-based MVC PHP web application framework. Yii is pronounced as "Yee" or [ji:] and in Chinese it means "simple and evolutionary" and it can be an acronym for "Yes It Is!". | https://en.wikipedia.org/wiki/Yii |
| Yacc | Yacc (Yet Another Compiler-Compiler) is a computer program for the Unix operating system. It is a Look Ahead Left-to-Right (LALR) parser generator, generating a parser, the part of a compiler that tries to make syntactic sense of the source code, specifically a LALR parser, based on an analytic grammar written in a notation similar to Backus–Naur Form (BNF). Yacc itself used to be available as the default parser generator on most Unix systems, though it has since been supplanted as the default by more recent, largely compatible, programs. | https://en.wikipedia.org/wiki/Yacc |
| Yacas | Yacas is a general-purpose computer algebra system. The name is an acronym for Yet Another Computer Algebra System. Released under the GNU Lesser General Public License, Yacas is free software. YACAS is a program for symbolic manipulation of mathematical expressions. It uses its own programming language designed for symbolic as well as arbitrary-precision numerical computations. The system has a library of scripts that implement many of the symbolic algebra operations; new algorithms can be easily added to the library. YACAS comes with extensive documentation covering the scripting language, the functionality that is already implemented in the system, and the algorithms used. Its development started in early 1999.Yacas handles input and output in plain ASCII or in OpenMath, either interactively or in batch mode. | https://en.wikipedia.org/wiki/Yacas |
| Yabasic | Yabasic (Yet Another BASIC) is a free and open-source BASIC interpreter for Windows and Unix platforms. Yabasic was originally developed by Marc-Oliver Ihm, who released the last stable version 2.77.3 in 2016. From version 2.77.1, the project has adopted the MIT Licence as well as the source code being moved to GitHub to encourage others to participate in its development. | https://en.wikipedia.org/wiki/Yabasic |
| YAWL | YAWL (Yet Another Workflow Language) is a workflow language based on workflow patterns. The language is supported by a software system that includes an execution engine, a graphical editor and a worklist handler. The system is available as Open source software under the LGPL license. Production-level uses of the YAWL system include a deployment by first:utility and first:telecom in the UK to automate front-end service processes, and by the Australian film television and radio school to coordinate film shooting processes. The YAWL system has also been used for teaching in more than 20 universities. | https://en.wikipedia.org/wiki/YAWL |
| YARV | YARV (Yet another Ruby VM) is a bytecode interpreter that was developed for the Ruby programming language by Koichi Sasada. The goal of the project was to greatly reduce the execution time of Ruby programs. Since YARV has become the official Ruby interpreter for Ruby 1.9, it is also named KRI (Koichi's Ruby Interpreter), in the same vein as the original Ruby MRI, named for Ruby's creator Yukihiro Matsumoto. | https://en.wikipedia.org/wiki/YARV |
| YARA | YARA is the name of a tool primarily used in malware research and detection. It provides a rule-based approach to create descriptions of malware families based on textual or binary patterns. A description is essentially a Yara rule name, where these rules consist of sets of strings and a boolean expression. The language used has traits of Perl compatible regular expressions. | https://en.wikipedia.org/wiki/YARA |
| YAP | YAP is an open-source, high-performance implementation of the Prolog programming language developed at LIACC/Universidade do Porto and at COPPE Sistemas/UFRJ. Its Prolog engine is based in the WAM (Warren Abstract Machine), with several optimizations for better performance. YAP follows the Edinburgh tradition, and is largely compatible with the ISO-Prolog standard and with Quintus Prolog and SICStus Prolog. YAP has been developed since 1985. The original version was written in assembly, C and Prolog, and achieved high performance on m68k-based machines. | https://en.wikipedia.org/wiki/YAP_%28Prolog%29 |
| YAML | YAML (YAML Ain't Markup Language) is a human-readable data serialization language. It is commonly used for configuration files, but could be used in many applications where data is being stored (e.g. debugging output) or transmitted (e.g. document headers). YAML targets many of the same communications applications as XML, but has taken a more minimal approach which intentionally breaks compatibility with SGML. YAML 1.2 is a superset of JSON, another minimalist data serialization format where braces and brackets are used instead of indentation. Custom data types are allowed, but YAML natively encodes scalars (such as strings, integers, and floats), lists, and associative arrays (also known as hashes or dictionaries). These data types are based on the Perl programming language, though all commonly used high-level programming languages share very similar concepts. YAML supports both Python-style indentation to indicate nesting, and a more compact format that uses [] for lists and {} for hashes. The colon-centered syntax used to express key-value pairs is inspired by electronic mail headers as defined in RFC 0822, and the document separator "---" is borrowed from MIME (RFC 2045). Escape sequences are reused from C, and whitespace wrapping for multi-line strings is inspired from HTML. Lists and hashes can contain nested lists and hashes, forming a tree structure; arbitrary graphs can be represented using YAML aliases (similar to XML in SOAP). YAML is intended to be read and written in streams, a feature inspired by SAX. Support for reading and writing YAML is available for several programming languages. Some source code editors such as Emacs and various integrated development environments have features that make editing YAML easier, such as folding up nested structures or automatically highlighting syntax errors. | https://en.wikipedia.org/wiki/YAML |
| Xtext | Xtext is an open-source software framework for developing programming languages and domain-specific languages (DSLs). Unlike standard parser generators, Xtext generates not only a parser, but also a class model for the abstract syntax tree, as well as providing a fully featured, customizable Eclipse-based IDE.Xtext is being developed in the Eclipse Project as part of the Eclipse Modeling Framework Project and is licensed under the Eclipse Public License. | https://en.wikipedia.org/wiki/Xtext |
| Xtend | Xtend is a general-purpose high-level programming language for the Java Virtual Machine. Syntactically and semantically Xtend has its roots in the Java programming language but focuses on a more concise syntax and some additional functionality such as type inference, extension methods, and operator overloading. Being primarily an object-oriented language, it also integrates features known from functional programming, e.g. lambda expressions. Xtend is statically typed and uses Java's type system without modifications. It is compiled to Java code and thereby seamlessly integrates with all existing Java libraries. The language Xtend and its IDE is developed as a project at Eclipse.org and participates in the annual Eclipse release train. The code is open source under the Eclipse Public License. Yet, the language can be compiled and run independent of the Eclipse platform. | https://en.wikipedia.org/wiki/Xtend |
| XeTeX | XeTeX ( ZEE-tekh or ; see also Pronouncing and writing "TeX") is a TeX typesetting engine using Unicode and supporting modern font technologies such as OpenType, Graphite and Apple Advanced Typography (AAT). It was originally written by Jonathan Kew and is distributed under the X11 free software license. Initially developed for Mac OS X only, it is now available for all major platforms. It natively supports Unicode and the input file is assumed to be in UTF-8 encoding by default. XeTeX can use any fonts installed in the operating system without configuring TeX font metrics, and can make direct use of advanced typographic features of OpenType, AAT and Graphite technologies such as alternative glyphs and swashes, optional or historic ligatures, and variable font weights. Support for OpenType local typographic conventions (locl tag) is also present. XeTeX even allows raw OpenType feature tags to be passed to the font. Microtypography is also supported. XeTeX also supports typesetting mathematics using Unicode fonts that contain special mathematical features, such as Cambria Math or Asana Math as an alternative to the traditional mathematical typesetting based on TeX font metrics. | https://en.wikipedia.org/wiki/XeTeX |
| XCAS | Xcas is a user interface to Giac, a free, basic Computer Algebra System (CAS) for Microsoft Windows, Apple macOS and Linux/Unix. Giac can be used directly inside software written in C++. Giac has a compatibility mode with Maple and MuPAD and Qcas and ExpressionsinBar software and TI-89, TI-92, Voyage 200 and TI-Nspire calculators. Users can use Giac/Xcas as well as a free software compatible with Maple to develop formal algorithms or use it in other software. Among other things Xcas can solve equations and draw graphs. CmathOOoCAS, an OpenOffice.org plugin which allows formal calculation in Calc spreadsheet and Writer word processing, uses Xcas to perform calculations. | https://en.wikipedia.org/wiki/Xcas |
| XBase++ | Xbase++ is an object oriented programming language which has multiple inheritance and polymorphism. It is based on the XBase language dialect and conventions. It is 100% Clipper compatible language supporting multiple inheritance, polymorphism, object oriented programming. It supports the xBase data types, including Codeblocks. With Xbase++ it is possible to generate applications for Windows NT, 95, 98, Me, 2000, XP, VISTA and Windows 7. | https://en.wikipedia.org/wiki/XBase%2B%2B |
| Xupdate | XUpdate is a lightweight XML query language for modifying XML data. After some early enthusiastic development by a small team, the development of the standard faltered around the end of 2000 and it has never found widespread adoption. However, it has found a niche market of users not content to wait for the XQuery Update Facility extension of the W3C standard, XQuery. | https://en.wikipedia.org/wiki/Xupdate |
| XSD | XSD (XML Schema Definition), a recommendation of the World Wide Web Consortium (W3C), specifies how to formally describe the elements in an Extensible Markup Language (XML) document. It can be used by programmers to verify each piece of item content in a document. They can check if it adheres to the description of the element it is placed in.Like all XML schema languages, XSD can be used to express a set of rules to which an XML document must conform in order to be considered "valid" according to that schema. However, unlike most other schema languages, XSD was also designed with the intent that determination of a document's validity would produce a collection of information adhering to specific data types. Such a post-validation infoset can be useful in the development of XML document processing software. | https://en.wikipedia.org/wiki/XML_Schema_(W3C) |
| XS | XS is a Perl foreign function interface through which a program can call a C or C++ subroutine. XS or xsub is an abbreviation of "eXternal Subroutine", where external refers to programming languages external to Perl. XS also refers to a glue language for specifying calling interfaces supporting such interfaces (see below). | https://en.wikipedia.org/wiki/XS_(Perl) |
| XQuery | XQuery (XML Query) is a query and functional programming language that queries and transforms collections of structured and unstructured data, usually in the form of XML, text and with vendor-specific extensions for other data formats (JSON, binary, etc.). The language is developed by the XML Query working group of the W3C. The work is closely coordinated with the development of XSLT by the XSL Working Group; the two groups share responsibility for XPath, which is a subset of XQuery. XQuery 1.0 became a W3C Recommendation on January 23, 2007. XQuery 3.0 became a W3C Recommendation on April 8, 2014. XQuery 3.1 became a W3C Recommendation on March 21, 2017. "The mission of the XML Query project is to provide flexible query facilities to extract data from real and virtual documents on the World Wide Web, therefore finally providing the needed interaction between the Web world and the database world. Ultimately, collections of XML files will be accessed like databases". | https://en.wikipedia.org/wiki/XQuery |
| XProc | XProc is a W3C Recommendation to define an XML transformation language to define XML Pipelines. Below is an example abbreviated XProc file: This is a pipeline that consists of two atomic steps, XInclude and Validate. The pipeline itself has three inputs, “source” (a source document), “schemas” (a list of W3C XML Schemas) and “parameters” (for passing parameters). The XInclude step reads the pipeline input “source” and produces a result document. The Validate step reads the pipeline input “schemas” and the output from the XInclude step and produces a result document. The result of the validation, “result”, is the result of the pipeline. Here is an equivalent less abbreviated XProc pipeline: | https://en.wikipedia.org/wiki/XProc |
| XPath | XPath (XML Path Language) is a query language for selecting nodes from an XML document. In addition, XPath may be used to compute values (e.g., strings, numbers, or Boolean values) from the content of an XML document. XPath was defined by the World Wide Web Consortium (W3C). | https://en.wikipedia.org/wiki/XPath |
| XPages | XPages is an IBM extension of Java Server Faces with a server side JavaScript runtime and the built-in NoSQL database IBM Domino. It allows data from IBM Notes and Relational Databases to be displayed to browser clients on all platforms. The programming model is based on web development languages and standards including JavaScript, Ajax, Java, the Dojo Toolkit, Server-side JavaScript and JavaServer Faces. XPages uses IBM Domino, IBM's rapid application development platform, including functionality such as the document-oriented database. | https://en.wikipedia.org/wiki/XPages |
| XPL0 | XPL0 is a computer programming language that is essentially a cross between Pascal and C. It was created in 1976 by Peter J. R. Boyle who wanted a high-level language for his microcomputer and wanted something more sophisticated than BASIC, which was the dominant language for personal computers at the time. XPL0 is based on PL/0, an example compiler in the book Algorithms + Data Structures = Programs by Niklaus Wirth. The first XPL0 compiler was written in ALGOL. It generated instructions for a pseudo-machine that was implemented as an interpreter on a Digital Group computer based on the 6502 microprocessor. The compiler was converted from ALGOL to XPL0 and was then able to compile itself and run on a microcomputer. XPL0 soon proved its worth in a variety of products based on the 6502. These embedded systems would otherwise have had their code written in assembly language, which is much more tedious to do. Boyle used XPL0 to write a disk operating system called Apex. Beginning in 1980 this was sold, along with XPL0, as an alternative to Apple DOS for the Apple II computer, which was based on the 6502. Since those early years XPL0 has migrated to other processors and many features have been added. Open source versions of the compilers for IBM-style PCs are available from the link below. | https://en.wikipedia.org/wiki/XPL0 |
| XPL | XPL is a programming language based on PL/I, a portable one-pass compiler written in its own language, and a parser generator tool for easily implementing similar compilers for other languages. XPL was designed in 1967 as a way to teach compiler design principles and as starting point for students to build compilers for their own languages. XPL was designed and implemented by William McKeeman and David B. Wortman at University of California, Santa Cruz and James J. Horning and others at Stanford University. XPL was first announced at the 1968 Fall Joint Computer Conference. The methods and compiler are described in detail in the 1971 textbook A Compiler Generator. They called the combined work a 'compiler generator'. But that implies little or no language- or target-specific programming is required to build a compiler for a new language or new target. A better label for XPL is a translator writing system. It helps to write a compiler with less new or changed programming code. | https://en.wikipedia.org/wiki/XPL |
| XOTcl | XOTcl is an object-oriented extension for the Tool Command Language created by Gustaf Neumann and Uwe Zdun. It is a derivative of MIT OTcl. XOTcl is based on a dynamic object system with metaclasses which as influenced by CLOS. Class and method definitions are completely dynamic. XOTcl provides language support for design patterns via filters and decorator mixins. | https://en.wikipedia.org/wiki/XOTcl |
| XMTC | XMTC (for explicit multi-threading C) is a shared-memory parallel programming language. It is an extension of the C programming language which strives to enable easy PRAM-like programming based on the explicit multi-threading paradigm. It is developed as part of the XMT PRAM-On-Chip vision by a research team at the University of Maryland, College Park, led by Dr. Uzi Vishkin. The philosophy of XMTC and the whole XMT project is that parallel programming is a hard intellectual task and the approach of building a hardware system first and then figuring out how to program them has not had much success. For that reason a robust algorithmic theory and a reasonably easy hardware abstraction should be the specifications that guide how to build a new parallel architecture and programming language. For parallel algorithms the algorithmic theory that has the largest body of literature is called PRAM (parallel random-access machine ). This is not a coincidence, since PRAM is a natural way in which to think algorithmically in parallel. In the early 1990s the PRAM model was deemed unrealistic because the hardware abstraction it was based on could not be implemented (because of low inter-chip bandwidth and high latency). Now that multiple processors can be put on a single chip, these limitations are no longer present. The XMT architecture takes advantage of this excess on-chip real estate to implement a PRAM abstraction. The XMTC language is a modest extension of C and a work in progress. The basic premise is that the programmer is responsible for exposing all the available parallelism. While this sounds simple and many earlier approaches share this ideal, in practice, if the programmer defines too large a number of parallel tasks and the tasks are short, the program will perform very poorly. The way around that is to combine short parallel tasks into a longer one, which is usually the responsibility of the programmer. In XMTC it is possible for the language to do that automatically, lifting the burden from the programmer. Software release of XMTC: PRAM-like programming allows experimenting with XMTC programming on standard computers. | https://en.wikipedia.org/wiki/XMTC |
| XDR Schema | XML-Data Reduced (XDR) was a schema language for specifying and validating XML documents. In January 1998, Microsoft, the University of Edinburgh and others submitted a proposal for an XML schema language called XML-Data to the World Wide Web Consortium. XML-Data Reduced was a subset of XML-Data, with some corrections and amendments submitted in July 1998.The XML Schema (W3C) effort in the World Wide Web Consortium (W3C) received several other proposals, and while the final result has some similarities to the XML-Data proposal, it is significantly different. XDR was implemented in SQL Server 2000 and BizTalk Server 2000. Once the XML Schema Definition was finalized in 2001, Microsoft products and tools added support for it, and XDR was gradually phased out. Microsoft XML Core Services provided XDR schema support from versions 2.0 up to - but not including - version 6.0. | https://en.wikipedia.org/wiki/XDR_Schema |
| XL | XL ("eXtensible Language") is the first and so far the only computer programming language designed to support concept programming.XL features programmer-reconfigurable syntax and semantics. Compiler plug-ins can be used to add new features to the language. A base set of plug-ins implements a relatively standard imperative language. Programmers can write their own plug-ins to implement application-specific notations, such as symbolic differentiation, which can then be used as readily as built-in language features. | https://en.wikipedia.org/wiki/XL_(programming_language) |
| XGMML | XGMML (the eXtensible Graph Markup and Modeling Language) is an XML application based on GML which is used for graph description. Technically, while GML is not related to XML nor SGML, XGMML is an XML application that is so designed that there's a 1:1 relation towards GML for trivial conversion between the two formats. | https://en.wikipedia.org/wiki/XGMML |
| Xgboost | XGBoost is an open-source software library which provides a gradient boosting framework for C++, Java, Python,R, and Julia. It works on Linux, Windows, and macOS. From the project description, it aims to provide a "Scalable, Portable and Distributed Gradient Boosting (GBM, GBRT, GBDT) Library". Other than running on a single machine, it also supports the distributed processing frameworks Apache Hadoop, Apache Spark, and Apache Flink. It has gained much popularity and attention recently as it was the algorithm of choice for many winning teams of a number of machine learning competitions. | https://en.wikipedia.org/wiki/Xgboost |
| Xbasic | XBasic is a variant of the BASIC programming language that was developed in the late 1980s for the Motorola 88000 CPU and Unix by Max Reason. In the early 1990s it was ported to Windows and Linux, and since 1999 it has been available as open source software with its runtime library under the LGPL license. It should not be confused with TI Extended BASIC, which is sometimes called XBasic or X Basic. Xbasic should also not be confused with the Xbasic language used in Alpha Software's Alpha Anywhere and Alpha Five products. Alpha Software has developed Xbasic as a proprietary language for its products. Alpha Software's Xbasic is not connected in any way at all to the version of Xbasic described in this article. Max Reason discontinued his support, and development since has been overseen by Eddie Penninkhof. Version 6.2.3 was the last official release, released on 27 October 2002. | https://en.wikipedia.org/wiki/Xbasic |
| XBRL | XBRL (eXtensible Business Reporting Language) is a freely available and global framework for exchanging business information. XBRL allows the expression of semantic meaning commonly required in business reporting. The language is XML-based and uses the XML syntax and related XML technologies such as XML Schema, XLink, XPath, and Namespaces. One use of XBRL is to define and exchange financial information, such as a financial statement. The XBRL Specification is developed and published by XBRL International, Inc. (XII). XBRL is a standards-based way to communicate and exchange business information between business systems. These communications are defined by metadata set out in taxonomies, which capture the definition of individual reporting concepts as well as the relationships between concepts and other semantic meaning. Information being communicated or exchanged is provided within an XBRL instance. Early users of XBRL included regulators such as the U.S. Federal Deposit Insurance Corporation and the Committee of European Banking Supervisors (CEBS). Common functions in many countries that make use of XBRL include regulators of stock exchanges and securities, banking regulators, business registrars, revenue reporting and tax-filing agencies, and national statistical agencies. A wiki repository of XBRL projects is available to be freely explored and updated. Within the last ten years, the Securities and Exchange Commission (SEC), the United Kingdom's HM Revenue and Customs (HMRC), and Singapore's Accounting and Corporate Regulatory Authority (ACRA), had begun to require companies to use it, and other regulators were following suit. Development of the SEC's initial US GAAP Taxonomy was led by XBRL US and was accepted and deployed for use by public companies in 2008 in phases, with the largest filers going first: foreign companies which use International Financial Reporting Standards (IFRS) are expected to submit their financial returns to the SEC using XBRL once the IFRS taxonomy has been accepted by the SEC. In the UK in 2011, both HMRC and Companies House accepted XBRL in the iXBRL format. XBRL was adopted by the Ministry of Corporate Affairs (MCA) of India for filing financial and costing information with the Central Government. | https://en.wikipedia.org/wiki/XBRL |
| XBLite | XBLite is a free Open Source BASIC programming language compiler and development system. It was started in 2001 by David Szafranski in order to provide a Windows exclusive version of the XBasic dialect. XBLite is released under the GNU GPL licensing scheme, Standard libraries are released under the GNU LGPL licensing scheme. The XBLite syntax is very similar to that of XBasic and somewhat similar to Microsoft's QuickBASIC in that it is a procedural language capable of subs and functions. XBLite also has 64 bit integer data type, User Defined Types and the ability to have multiple modules in order to create GUI applications or games. | https://en.wikipedia.org/wiki/XBLite |
| XML Binding Language | XBL (XML Binding Language) is an XML-based markup language used to declare the behavior and look of XUL-widgets and XML elements. Development of the XBL specification was abandoned by the W3C in 2012. XBL was developed by the Mozilla project for use in the Mozilla Application Suite; the language is not currently described by any formal standard and is thus proprietary to Mozilla, with the only implementation being the Gecko layout engine. XBL 2.0 is the latest version of XBL. XBL 1.0 was first developed at Netscape in 2000 and announced in 2001. In August 2015, Mozilla announced that the use of XBL for creating Firefox add-ons would be deprecated in the future in favour of WebExtensions. Pale Moon, a fork of Firefox, will continue to support XBL indefinitely. | https://en.wikipedia.org/wiki/XBL |
| X10 | X10 is a programming language being developed by IBM at the Thomas J. Watson Research Center as part of the Productive, Easy-to-use, Reliable Computing System (PERCS) project funded by DARPA's High Productivity Computing Systems (HPCS) program. Its primary authors are Kemal Ebcioğlu, Vijay Saraswat, Saravanan Arumugam, and Vivek Sarkar. X10 is designed specifically for parallel computing using the partitioned global address space (PGAS) model. A computation is divided among a set of places, each of which holds some data and hosts one or more activities that operate on those data. It has a constrained type system for object-oriented programming, a form of dependent types. Other features include user-defined primitive struct types; globally distributed arrays, and structured and unstructured parallelism. X10 uses the concept of parent and child relationships for activities to prevent the lock stalemate that can occur when two or more processes wait for each other to finish before they can complete. An activity may spawn one or more child activities, which may themselves have children. Children cannot wait for a parent to finish, but a parent can wait for a child using the finish command. | https://en.wikipedia.org/wiki/X10_(programming_language) |
| X PixMap | X PixMap (XPM) is an image file format used by the X Window System, created in 1989 by Daniel Dardailler and Colas Nahaboo working at Bull Research Center at Sophia Antipolis, France, and later enhanced by Arnaud Le Hors.It is intended primarily for creating icon pixmaps, and supports transparent pixels. Derived from the earlier XBM syntax, it is a plain text file in the XPM2 format or of a C programming language syntax, which can be included in a C program file. | https://en.wikipedia.org/wiki/X_PixMap |
| Wyvern | Wyvern is a computer programming language created by Jonathan Aldrich and Alex Potanin for the development of web and mobile applications with security and assurance being number one priority. Wyvern supports object capabilities, it is structurally typed, and aims to make secure way of programming easier than insecure - as described in the Wyvern Manifesto. One of the early available features that make Wyvern special is a way to safely use multiple programming languages within the same program so programmers can use the language most appropriate for each function while at the same time increasing the program's security. It is currently in a prototype stage and distributed under a GPLv2 license. | https://en.wikipedia.org/wiki/Wyvern_(programming_language) |
| WFL | Work Flow Language, or WFL ("wiffle") is the process control language for the Burroughs large systems, including the Unisys ClearPath/MCP series, and their operating system Master Control Program. Developed soon after the B5000 in 1961, WFL is the ClearPath equivalent of the Job Control Language (JCL) on IBM mainframes and the shell scripts of Unix-like operating systems. Unlike JCL, WFL is a high-level structured language complete with subroutines (procedures and functions) with arguments and high-level program control flow instructions. WFL programs are compiled to binary executables like any other MCP subject. WFL is used for high-level system operations, such as running tasks, moving and copying files, providing high-level recoverability. Thus it is not a general purpose language in that you would not use it to do general computations. You can open and close files to check their attributes for example; however, you cannot read or change their contents in WFL – that you do in a general purpose language, and invoke it as a task from WFL. WFL has a high-level ALGOL-like readable syntax. It has none of the low-level assembler-like commands of JCL like //SYSIN DD, etc. in order to connect hardware devices and open files for programs. All WFL constructs deal with the high-level abstractions of tasks and files. Parameters are also real HLL parameters, not the $1, $2... style position parameters of shell scripts. WFL also has an instruction block command which is used to give operators instructions needed to run the current job. These instructions are displayed using the 'IB' operator command. WFL was a compiled language on the medium systems. Because some OS interfaces may change from release to release, Medium Systems WFL code included a copy of the source in the object file. Upon executing a WFL job it would check to determine if the object was compatible with the OS version. If not it would trigger a recompile of the object using the source embedded in the object code. | https://en.wikipedia.org/wiki/Work_Flow_Language |
| WordPress | WordPress is a free and open-source content management system (CMS) based on PHP and MySQL. To function, WordPress has to be installed on a web server, which would either be part of an Internet hosting service or a network host in its own right. An example of the first scenario may be a service like WordPress.com, for example, and the second case could be a computer running the software package WordPress.org. A local computer may be used for single-user testing and learning purposes. Features include a plugin architecture and a template system. WordPress was used by more than 27.5% of the top 10 million websites as of February 2017. WordPress is reportedly the most popular website management or blogging system in use on the Web, supporting more than 60 million websites. WordPress has also been used for other application domains such as pervasive display systems (PDS). WordPress was released on May 27, 2003, by its founders, Matt Mullenweg and Mike Little, as a fork of b2/cafelog. WordPress is released under the GPLv2 (or later) license. | https://en.wikipedia.org/wiki/WordPress |
| Mathematica | Wolfram Mathematica (usually termed Mathematica) is a modern technical computing system spanning most areas of technical computing — including neural networks, machine learning, image processing, geometry, data science, visualizations, and others. The system is used in many technical, scientific, engineering, mathematical, and computing fields. It was conceived by Stephen Wolfram and is developed by Wolfram Research of Champaign, Illinois. The Wolfram Language is the programming language used in Mathematica. | https://en.wikipedia.org/wiki/Mathematica |
| Wolfram Mathematica | Wolfram Mathematica (usually termed Mathematica) is a modern technical computing system spanning most areas of technical computing — including neural networks, machine learning, image processing, geometry, data science, visualizations, and others. The system is used in many technical, scientific, engineering, mathematical, and computing fields. It was conceived by Stephen Wolfram and is developed by Wolfram Research of Champaign, Illinois. The Wolfram Language is the programming language used in Mathematica. | https://en.wikipedia.org/wiki/Wolfram_Mathematica |
| WOL | Wol, WoL or WOL may refer to: ComputingWake-on-LAN, (/wɒl/) an Ethernet standard that allows computers to be powered on by a network message An unofficial initialism for Web Ontology Language .wol, file extension for the WOLF eBook file format World Online, a defunct European internet service provider Write-only language, a programming which facilitates hard to read codeComputer gamesWar of Legends, (/wɒl/) a fantasy real-time strategy game published by Jagex Games Studio Warhammer Online, abbreviation used internally by Games Workshop staff StarCraft II: Wings of Liberty Westwood Online, multi-player game mode by Westwood Studios, superseded by XWISPublishingEditorial language, (/wɒl/) acronym for write on line, a dotted or solid line in an exercise book for students to write in an answer.OtherOwl (Winnie the Pooh), character in the Winnie the Pooh stories, who spells his name "Wol" Wide outside lane, in bicycle transportation engineering WOL (AM), a radio station in Washington, D.C. WOL World Loud TV Wol Books, the first independent academic bookshop (opened 1981) at Royal Holloway College, now Royal Holloway University of London, later taken over in 1987 by Pentos Illawarra Regional Airport | https://en.wikipedia.org/wiki/Wol |
| Wirth syntax notation | Wirth syntax notation (WSN) is a metasyntax, that is, a formal way to describe formal languages. Originally proposed by Niklaus Wirth in 1977 as an alternative to Backus–Naur form (BNF). It has several advantages over BNF in that it contains an explicit iteration construct, and it avoids the use of an explicit symbol for the empty string (such as |
https://en.wikipedia.org/wiki/Wirth_syntax_notation |
| WML | Wireless Markup Language (WML), based on XML, is a now-obsolete markup language intended for devices that implement the Wireless Application Protocol (WAP) specification, such as mobile phones. It provides navigational support, data input, hyperlinks, text and image presentation, and forms, much like HTML (HyperText Markup Language). It preceded the use of other markup languages now used with WAP, such as HTML itself, and XHTML (which are gaining in popularity as processing power in mobile devices increases). | https://en.wikipedia.org/wiki/Wireless_Markup_Language |
| Winbatch | Winbatch is a Microsoft Windows scripting language originally developed by Wilson WindowWare and currently supported, maintained and enhanced by Island Lake Consulting LLC. Its environment includes an interpreter and a code editor along with a dialog designer and optional compiler to create self-contained executables. Its language structure and syntax is a cross between DOS batch command, Basic, Fortran, and C. It has been developed over the years with functions added and support for things like .Net, ActiveX controls, COM (OLE), Unicode, UAC and code signing. | https://en.wikipedia.org/wiki/Winbatch |
| WinWrap Basic | WinWrap Basic (WWB) by Polar Engineering, Inc. is a third-party macro language based on Visual Basic used with programmes of various types which its vendor touts as an alternative to ActiveX (e.g. VBScript, JScript, PerlScript, Rexx-based WSH engines and others), Visual Basic for Applications, and VSTA for this purpose. The WWB software package is used in conjunction with Microsoft development tools including Visual Studio, Visual Studio.NET, and the ActiveX scripting engines. The default file extension for programmes written in this language is .wwb WWB 10 has Windows Scripting Host functionality, i.e. it contains a scripting engine similar to the default and third-party language implementations for WSH. This engine is able to access both the .NET framework and the Component Object Model. The current version, 10.01, is available for different combinations of OS and platform. At this time there are four types of WWB, those being WWB.NET for the .NET object model (used with Visual Studio.NET 2005 and 2008 and Vista), .WWB-COM for the COM object model (Visual Studio and Visual Studio.NET earlier versions), both of which are used with all Windows 32 and 64-bit operating systems from Windows 95 to Windows Vista; the other two packages are for Windows CE and PocketPC & Windows Mobile. Earlier versions of WWB ran under Windows 3.1 and ostensibly OS/2 Warp 3 as well. WWB is integrated into many software packages including most categories of PC and server software (e.g. earlier versions of Host Explorer, which now uses two proprietary scripting languages, Hummingbird QuickScript and Hummingbird Basic) as well as software used to run various types of equipment like mass spectrometers and other lab equipment. | https://en.wikipedia.org/wiki/WinWrap_Basic |
| Whitespace | Whitespace is an esoteric programming language developed by Edwin Brady and Chris Morris at the University of Durham (also developers of the Kaya and Idris programming languages). It was released on 1 April 2003 (April Fool's Day). Its name is a reference to whitespace characters. Unlike most programming languages, which ignore or assign little meaning to most whitespace characters, the Whitespace interpreter ignores any non-whitespace characters. Only spaces, tabs and linefeeds have meaning. An interesting consequence of this property is that a Whitespace program can easily be contained within the whitespace characters of a program written in another language, except possibly in languages which depend on spaces for syntax validity such as Python, making the text a polyglot. The language itself is an imperative stack-based language. The virtual machine on which the programs run has a stack and a heap. The programmer is free to push arbitrary-width integers onto the stack (currently there is no implementation of floating point numbers) and can also access the heap as a permanent store for variables and data structures. | https://en.wikipedia.org/wiki/Whitespace_(programming_language) |
| Whiley | Whiley is an experimental programming language that combines features from the functional and imperative paradigms, and supports formal specification through function preconditions, postconditions and loop invariants. The language uses flow-sensitive typing also known as "flow typing." The Whiley project began in 2009 in response to the "Verifying Compiler Grand Challenge" put forward by Tony Hoare in 2003. The first public release of Whiley was in June, 2010.Primarily developed by David Pearce, Whiley is an open source project with contributions from a small community. The system has been used for student research projects and in teaching undergraduate classes. It was supported between 2012 and 2014 by the Royal Society of New Zealand's Marsden Fund.The Whiley compiler generates code for the Java virtual machine and can inter-operate with Java and other JVM based languages. | https://en.wikipedia.org/wiki/Whiley_(programming_language) |
| WML | Website Meta Language (WML) and its associated command wmk are together a free and extensible web designer's off-line HTML generation toolkit for Unix, distributed under the GNU General Public License (GPL v2). It works as an off-line content management system. It is written in ANSI C and Perl 5, built via a GNU Autoconf based source tree and runs out-of-the-box on all major Unix derivates. WML consists of a control frontend driving up to nine backends in a sequential pass-oriented filtering scheme. Each backend provides one particular core language. WML additionally ships with a set of include files which provide higher-level features. WML's nine backends are: Pass 1: Source Reading and Include File Expansion (ipp) Pass 2: HTML Macro Construct Expansion (mp4h) Pass 3: Perl 5 Programming Construct Expansion (eperl) Pass 4: M4 Macro Construct Expansion (gm4) Pass 5: Diversion Filter (divert) Pass 6: Character and String Substitution (asubst) Pass 7: HTML Fixup (htmlfix) Pass 8: Line Stripping and Output Fixup (htmlstrip) Pass 9: Output Splitting and Final Writing (slice) | https://en.wikipedia.org/wiki/Website_Meta_Language |
| WebP | WebP is an image format employing both lossy and lossless compression. It is currently developed by Google, based on technology acquired with the purchase of On2 Technologies.As a derivative of the VP8 video format, it is a sister project to the WebM multimedia container format. WebP-related software is released under a BSD license.The format was first announced on 30 September 2010 as a new open standard for lossy compressed true-color graphics on the web, producing smaller files of comparable image quality to the older JPEG scheme. On October 3, 2011 Google announced WebP support for animation, ICC profile, XMP metadata, and tiling (compositing very large images from maximum 16384×16384 tiles).On 18 November 2011 Google began to experiment with lossless compression and support for transparency (alpha channel) in both lossless and lossy modes; support has been enabled by default in libwebp 0.2.0 (16 August 2012). According to Google's measurements, a conversion from PNG to WebP results in a 45% reduction in file size when starting with PNGs found on the web, and a 28% reduction compared to PNGs that are recompressed with pngcrush and PNGOUT. | https://en.wikipedia.org/wiki/WebP |
| WebGL | WebGL (Web Graphics Library) is a JavaScript API for rendering interactive 2D and 3D graphics within any compatible web browser without the use of plug-ins. WebGL is integrated completely into all the web standards of the browser allowing GPU accelerated usage of physics and image processing and effects as part of the web page canvas. WebGL elements can be mixed with other HTML elements and composited with other parts of the page or page background. WebGL programs consist of control code written in JavaScript and shader code that is written in OpenGL Shading Language (GLSL), a language similar to C or C++, and is executed on a computer's graphics processing unit (GPU). WebGL is designed and maintained by the non-profit Khronos Group. | https://en.wikipedia.org/wiki/WebGL |
| WebDNA | WebDNA is a server-side scripting, interpreted language with an embedded database system, specifically designed for the World Wide Web. Its primary use is in creating database-driven dynamic web page applications. Released in 1995, the name was registered as a trademark in 1998. WebDNA is currently maintained by WebDNA Software Corporation. | https://en.wikipedia.org/wiki/WebDNA |
| WebAssembly | WebAssembly (Wasm, WA) is a web standard that defines a binary format and a corresponding assembly-like text format for executable code in Web pages. It is meant to enable executing code nearly as fast as running native machine code. It was envisioned to complement JavaScript to speed up performance-critical parts of web applications and later on to enable web development in languages other than JavaScript. WebAssembly does not attempt to replace JavaScript, but to complement it. It is developed at the World Wide Web Consortium (W3C) with engineers from Mozilla, Microsoft, Google and Apple.It is executed in a sandbox in the web browser after a verification step. Programs can be compiled from high-level languages into Wasm modules and loaded as libraries from within JavaScript applets. | https://en.wikipedia.org/wiki/WebAssembly |
| WebIDL | Web IDL is an interface description language (IDL) format for describing application programming interfaces (APIs) that are intended to be implemented in web browsers. | https://en.wikipedia.org/wiki/Web_IDL |
| Watcom | Watcom International Corporation was founded in 1981 by three former employees of the Computer Systems Group (Fred Crigger, Ian McPhee, and Jack Schueler) at the University of Waterloo, in Waterloo, Ontario, Canada. Watcom produced a variety of tools, including the well-known Watcom C/C++ compiler introduced in 1988. | https://en.wikipedia.org/wiki/Watcom |
| WSFN | WSFN (Which Stands for Nothing) is an interpreted programming language for controlling robots created by Li-Chen Wang. It was designed to be as small as possible, a "tiny" language, similar to Wang's earlier effort, Palo Alto Tiny BASIC. WSFN was first published in Dr. Dobb's Journal in September 1977. The language consists primarily of single-letter commands to tell a robot to move in certain directions, while other commands perform tests or basic mathematical operations. These can be grouped into named macros to produce more complex programs. The original version also included code that simulated the robot as a cursor on the VDM-1 display, or graphically on a Cromemco Dazzler display. Today, this is known as turtle graphics. Extended WSFN is an implementation created for the Atari 8-bit family of home computers written by Harry Stewart and published by the Atari Program Exchange in 1981. In addition to supporting turtle graphics, it adds a number of commands to control the graphics and sound capabilities of that platform. It was offered as a "beginner's language with emphasis on graphics". | https://en.wikipedia.org/wiki/WSFN_%28programming_language%29 |
| WMLScript | WMLScript is a procedural programming language and dialect of JavaScript used for WML pages and is part of the Wireless Application Protocol (WAP). WMLScript is a client-side scripting language and is similar to JavaScript. Just like JavaScript WMLScript is used for tasks such as user input validation, generation of error message and other Dialog boxes etc. WMLScript is based on ECMAScript (European Computer Manufacturers Association Script), which is JavaScript's standardized version. Thus the syntax of WMLScript is similar to JavaScript but not fully compatible.Despite the syntactical similarities, they are two different languages. WMLScript does not have objects or array, which JavaScript has. On the other hand, it allows you to declare and include external functions from other scripts. WMLScript is optimised for low power devices, and is a compiled language. | https://en.wikipedia.org/wiki/WMLScript |
| WHOIS | WHOIS (pronounced as the phrase "who is") is a query and response protocol that is widely used for querying databases that store the registered users or assignees of an Internet resource, such as a domain name, an IP address block or an autonomous system, but is also used for a wider range of other information. The protocol stores and delivers database content in a human-readable format. The WHOIS protocol is documented in RFC 3912. | https://en.wikipedia.org/wiki/WHOIS |
| WDDX | WDDX (Web Distributed Data eXchange) is a programming language-, platform- and transport-neutral data interchange mechanism designed to pass data between different environments and different computers. | https://en.wikipedia.org/wiki/WDDX |
| WATFIV | WATFIV, or WATerloo FORTRAN IV, developed at the University of Waterloo, Canada is an implementation of the Fortran computer programming language. It is the successor of WATFOR. WATFIV was used from the late 1960s into the mid-1980s. WATFIV was in turn succeeded by later versions of WATFOR. Because it could complete the three usual steps ("compile-link-go") in just one pass, the system became popular for teaching students computer programming. | https://en.wikipedia.org/wiki/WATFIV |
| Vue | Vue.js (commonly referred to as Vue; pronounced , like view) is an open-source JavaScript framework for building user interfaces. Integration into projects that use other JavaScript libraries is simplified with Vue because it is designed to be incrementally adoptable. Vue can also function as a web application framework capable of powering advanced single-page applications. | https://en.wikipedia.org/wiki/Vue.js |
| VisualWorks | VisualWorks is a cross-platform implementation of the Smalltalk language. It is implemented as a development system based on "images", which are dynamic collections of software objects, each contained in a system image. The lineage of VisualWorks goes back to the first Smalltalk-80 implementation by Xerox PARC. In the late 1980s, a group of Smalltalk-80 developers spun off ParcPlace Systems to further develop Smalltalk-80 as a commercial product. The commercial product was initially called ObjectWorks, and then VisualWorks. On August 31, 1999, the VisualWorks product was sold to Cincom. VisualWorks runs under many operating systems, including Windows, Mac OS X, Linux, and several versions of Unix. VisualWorks has a very active third-party developers community, with a non-commercial version available free. The non-commercial version has all the power and functionality of the commercial version. In both versions, as in all Smalltalks, the user can see all the source code. This includes all the system classes, including the browser and GUI builder. VisualWorks supports cross-platform development projects, because of its built-in multi-platform features. For example, a GUI application needs to be developed only once, and can then be switched to different widget styles. A VisualWorks application can be run on all supported platforms without any modifications. Only the virtual machine is platform-dependent. | https://en.wikipedia.org/wiki/VisualWorks |
| Visual Tool Markup Language | Visual Tool Markup Language, a user interface markup language used by Macromedia HomeSite, ColdFusion Studio and JRun Studio. VTML is used for tag editors and custom dialogs shipped with these applications and can be used to extend the user interface and to support additional tag-based languages. It is documented in help files included with these applications or available online, notably in the "VTML Reference" and "Customizing the Development Environment" sections. Wizard Markup Language (WIZML) is a sub-language of VTML that defines the logic used by user interface wizards and tag editors. | https://en.wikipedia.org/wiki/VTML |
| Visual Test | Visual Test, originally known as MS-Test, was an automated testing tool for Windows applications developed by Microsoft and later sold to Rational Software. | https://en.wikipedia.org/wiki/Visual_Test |
| Visual Studio Code | Visual Studio Code is a source code editor developed by Microsoft for Windows, Linux and macOS. It includes support for debugging, embedded Git control, syntax highlighting, intelligent code completion, snippets, and code refactoring. It is also customizable, so users can change the editor's theme, keyboard shortcuts, and preferences. It is free and open-source, although the official download is under a proprietary license.Visual Studio Code is based on Electron, a framework which is used to deploy Node.js applications for the desktop running on the Blink layout engine. Although it uses the Electron framework, the software does not use Atom and instead employs the same editor component (codenamed "Monaco") used in Visual Studio Team Services (formerly called Visual Studio Online).In the Stack Overflow 2018 Developer Survey, Visual Studio Code was ranked the most popular developer environment tool, with 34.9% of 75,398 respondents claiming to use it. | https://en.wikipedia.org/wiki/Visual_Studio_Code |
| Visual Smalltalk Enterprise | Visual Smalltalk Enterprise (VSE) is a Smalltalk dialect that runs only on Microsoft Windows, and is the last in a long line of Smalltalk implementations first produced by Digitalk and now available through Cincom. Active development has stopped since late 1997 and VSE is now only available as a version called VSE 2000, and only to licensed users of previous VSE versions. | https://en.wikipedia.org/wiki/Visual_Smalltalk_Enterprise |
| Visual Prolog | Visual Prolog, also formerly known as PDC Prolog and Turbo Prolog, is a strongly typed object-oriented extension of Prolog. As Turbo Prolog, it was marketed by Borland but it is now developed and marketed by the Danish firm Prolog Development Center (PDC) that originally developed it. Visual Prolog can build Microsoft Windows GUI-applications, console applications, DLLs (dynamic link libraries), and CGI-programs. It can also link to COM components and to databases by means of ODBC. Logic languages are traditionally interpreted, but Visual Prolog is compiled. This provides the important improvement of converting traditional Prolog-typical run-time errors to compiler warnings, which ensures a better robustness of the finished applications. The core of Visual Prolog are Horn clauses, algebraic datatypes, pattern matching and controlled non-determinism like in traditional Prolog, but unlike traditional Prolog, Visual Prolog has always been strongly and statically typed. | https://en.wikipedia.org/wiki/Visual_Prolog |
| Visual Paradigm | Visual Paradigm (VP-UML) is a UML CASE Tool supporting UML 2, SysML and Business Process Modeling Notation (BPMN) from the Object Management Group (OMG). In addition to modeling support, it provides report generation and code engineering capabilities including code generation. It can reverse engineer diagrams from code, and provide round-trip engineering for various programming languages. | https://en.wikipedia.org/wiki/Visual_Paradigm |
| Visual Objects | Visual Objects is an object-oriented computer programming language that is used to create computer programs that operate primarily under Windows. Although it can be used as a general-purpose programming tool, it is almost exclusively used to create database programs. The original Visual Objects project (code-named Aspen) was started as part of Nantucket's attempts to bring the Clipper language to Windows, and move from the procedural to the object-oriented style. It also converted Clipper from a p-code system to being a true native compiler and introduced more elements of the C language (such as typed variables), while including Windows extensions (such as COM, ODBC, and later ADO). With its symbol datatype, it offers the ability to form name-based linkages, which may be used to connect menu events to object methods or form direct linkages between server columns and controls. The Windows version was finally brought to market by Computer Associates. Unfortunately it was released before it was market-ready and in almost head-to-head competition with the first release of Borland's Delphi product. The language is still in use however the last release by GrafX Software was in 2012 of version 2.8 sp4 (version number 2838). GrafX announced that after this no new versions would be released. The next incarnation of the Visual Objects language is Vulcan.NET, written by GrafX from scratch to be both Visual Objects compatible and be a true CLS compliant .NET language, taking full advantage of the .NET framework. | https://en.wikipedia.org/wiki/Visual_Objects |
| J# | Visual J# (pronounced "jay-sharp") is an implementation of the J# programming language that was a transitional language for programmers of Java and Visual J++ languages, so they could use their existing knowledge and applications on .NET Framework. It was introduced in 2002 and discontinued in 2007, with support for the final release of the product continuing until October, 2017. J# worked with Java bytecode as well as source so it could be used to transition applications that used third-party libraries even if their original source code was unavailable. It was developed by the Hyderabad-based Microsoft India Development Center at HITEC City in India. | https://en.wikipedia.org/wiki/J_Sharp |
| Visual FoxPro | Visual FoxPro is a discontinued data-centric, object-oriented, procedural, programming language produced by Microsoft. It was derived from FoxPro (originally known as FoxBASE) which was developed by Fox Software beginning in 1984. It contained the fastest PC-based database engine available at the time. Fox Technologies merged with Microsoft in 1992, after which the software acquired further features and the prefix "Visual". The database engine is more powerful than the Microsoft Jet Database Engine which is used by Microsoft Access. FoxPro 2.6 worked on Mac OS, DOS, Windows, and Unix. Visual FoxPro 3.0, the first "Visual" version, reduced platform support to only Mac and Windows, and later versions 5, 6, 7, 8 and 9 were Windows-only. The current version of Visual FoxPro is COM-based and Microsoft has stated that they do not intend to create a Microsoft .NET version. Version 9.0, released in 2004 and updated in 2007, is the final version of the product. | https://en.wikipedia.org/wiki/Visual_FoxPro |
| Visual DialogScript | Visual DialogScript (VDS) is an interpreted programming language for Microsoft Windows. It can be used to create small, fast programs. VDS has a large number of dialog and graphical elements available to create professional looking programs. VDS programs have access to the Windows API; therefore, it is possible to write applications that can perform the same advanced tasks as other programming languages such as Visual Basic, C++, or Delphi. | https://en.wikipedia.org/wiki/Visual_DialogScript |
| Visual Basic | Visual Basic is a third-generation event-driven programming language and integrated development environment (IDE) from Microsoft for its Component Object Model (COM) programming model first released in 1991 and declared legacy during 2008. Microsoft intended Visual Basic to be relatively easy to learn and use. Visual Basic was derived from BASIC and enables the rapid application development (RAD) of graphical user interface (GUI) applications, access to databases using Data Access Objects, Remote Data Objects, or ActiveX Data Objects, and creation of ActiveX controls and objects. A programmer can create an application using the components provided by the Visual Basic program itself. Over time the community of programmers developed third-party components. Programs written in Visual Basic can also use the Windows API, which requires external function declarations. The final release was version 6 in 1998 (now known simply as Visual Basic). On April 8, 2008, Microsoft stopped supporting Visual Basic 6.0 IDE. The Microsoft Visual Basic team still maintains compatibility for Visual Basic 6.0 applications on Windows Vista, Windows Server 2008 including R2, Windows 7, Windows 8, Windows 8.1, Windows Server 2012, Windows 10 and Windows Server 2016 through its "It Just Works" program. In 2014, some software developers still preferred Visual Basic 6.0 over its successor, Visual Basic .NET. In 2014 some developers lobbied for a new version of the VB6 programming environment. In 2016, Visual Basic 6.0 won the technical impact award at The 19th Annual D.I.C.E. Awards. A dialect of Visual Basic, Visual Basic for Applications (VBA), is used as a macro or scripting language within several Microsoft applications, including Microsoft Office. | https://en.wikipedia.org/wiki/Visual_Basic |
| VBA | Visual Basic for Applications (VBA) is an implementation of Microsoft's event-driven programming language Visual Basic 6, which was discontinued in 2008, and its associated integrated development environment (IDE). Although Visual Basic is no longer supported or updated by Microsoft, VBA itself got upgraded in 2010 with the introduction of Visual Basic for Applications 7 in Microsoft Office applications. Visual Basic for Applications enables building user-defined functions (UDFs), automating processes and accessing Windows API and other low-level functionality through dynamic-link libraries (DLLs). It supersedes and expands on the abilities of earlier application-specific macro programming languages such as Word's WordBasic. It can be used to control many aspects of the host application, including manipulating user interface features, such as menus and toolbars, and working with custom user forms or dialog boxes. As its name suggests, VBA is closely related to Visual Basic and uses the Visual Basic Runtime Library. However, VBA code normally can only run within a host application, rather than as a standalone program. VBA can, however, control one application from another using OLE Automation. For example, VBA can automatically create a Microsoft Word report from Microsoft Excel data that Excel collects automatically from polled sensors. VBA can use, but not create, ActiveX/COM DLLs, and later versions add support for class modules. VBA is built into most Microsoft Office applications, including Office for Mac OS X (except version 2008), and other Microsoft applications, including Microsoft MapPoint and Microsoft Visio. VBA is also implemented, at least partially, in applications published by companies other than Microsoft, including ArcGIS, AutoCAD, CorelDraw, LibreOffice, Reflection, SolidWorks, and WordPerfect. | https://en.wikipedia.org/wiki/Visual_Basic_for_Applications |
| Visual Basic .NET | Visual Basic .NET (VB.NET) is a multi-paradigm, object-oriented programming language, implemented on the .NET Framework. Microsoft launched VB.NET in 2002 as the successor to its original Visual Basic language. Although the ".NET" portion of the name was dropped in 2005, this article uses "Visual Basic [.NET]" to refer to all Visual Basic languages released since 2002, in order to distinguish between them and the classic Visual Basic. Along with Visual C#, it is one of the two main languages targeting the .NET framework. Microsoft's integrated development environment (IDE) for developing in Visual Basic .NET language is Visual Studio. Most Visual Studio editions are commercial; the only exceptions are Visual Studio Express and Visual Studio Community, which are freeware. In addition, the .NET Framework SDK includes a freeware command-line compiler called vbc.exe. Mono also includes a command-line VB.NET compiler. | https://en.wikipedia.org/wiki/Visual_Basic_.NET |
| VisSim | VisSim is a visual block diagram program for simulation of dynamical systems and model based design of embedded systems, with its own visual language. It is developed by Visual Solutions of Westford, Massachusetts. Visual Solutions, has been acquired by Altair in August 2015 and its products have been rebranded as solidThinking Embed as a part of solidThinking's Model Based Development Suite. With solidThinking Embed, you can develop virtual prototypes of dynamic systems. Models are built by sliding blocks into the work area and wiring them together with the mouse. Embed automatically converts the control diagrams into C-code ready to be downloaded to the target hardware. VisSim or now solidThinking Embed uses a graphical data flow paradigm to implement dynamic systems based on differential equations. Version 8 adds interactive UML OMG 2 compliant state chart graphs that are placed in VisSim diagrams. This allows the modeling of state based systems such as startup sequencing of process plants or serial protocol decoding. | https://en.wikipedia.org/wiki/VisSim |
| vdscript | VirtualDub is a free and open-source video capture and video processing utility for Microsoft Windows written by Avery Lee. It is designed to process linear video streams, including filtering and recompression. It uses AVI container format to store captured video.The first version of VirtualDub, written for Windows 95, to be released on SourceForge was uploaded on August 20, 2000. | https://en.wikipedia.org/wiki/VirtualDub |
| Vim | Vim (; a contraction of Vi IMproved) is a clone, with additions, of Bill Joy's vi text editor program for Unix. It was written by Bram Moolenaar based on source for a port of the Stevie editor to the Amiga and first released publicly in 1991. Vim is designed for use both from a command-line interface and as a standalone application in a graphical user interface. Vim is free and open-source software and is released under a license that includes some charityware clauses, encouraging users who enjoy the software to consider donating to children in Uganda. The license is compatible with the GNU General Public License through a special clause allowing distribution of modified copies "under the GNU GPL version 2 or any later version".Although it was originally released for the Amiga, Vim has since been developed to be cross-platform, supporting many other platforms. In 2006, it was voted the most popular editor amongst Linux Journal readers; in 2015 the Stack Overflow developer survey found it to be the third most popular text editor; and in 2016 the Stack Overflow developer survey found it to be the fourth most popular development environment. | https://en.wikipedia.org/wiki/Vim_(text_editor) |
| Vim script | Vim (; a contraction of Vi IMproved) is a clone, with additions, of Bill Joy's vi text editor program for Unix. It was written by Bram Moolenaar based on source for a port of the Stevie editor to the Amiga and first released publicly in 1991. Vim is designed for use both from a command-line interface and as a standalone application in a graphical user interface. Vim is free and open-source software and is released under a license that includes some charityware clauses, encouraging users who enjoy the software to consider donating to children in Uganda. The license is compatible with the GNU General Public License through a special clause allowing distribution of modified copies "under the GNU GPL version 2 or any later version".Although it was originally released for the Amiga, Vim has since been developed to be cross-platform, supporting many other platforms. In 2006, it was voted the most popular editor amongst Linux Journal readers; in 2015 the Stack Overflow developer survey found it to be the third most popular text editor, and the fifth most popular development environment in 2018. | https://en.wikipedia.org/wiki/Vim_script |
| Vilnius BASIC | Vilnius BASIC is a dialect of the BASIC programming language running on the Elektronika BK-0010-01/BK-0011M and UKNC computers.It was a quite advanced BASIC and featured a runtime threaded code compiler that compiled the program when one entered the RUN command. The dialect was very close to MSX BASIC. The major differences were the lack of the PLAY, SOUND, VPOKE and PUT SPRITE operators, the inability to open several files at the same time, and the inability to use more than one operator on one line. Only the UKNC version had a full-screen editor. Machine-dependent features, like graphics operators parameters and PEEK/POKE addresses were also different. The software was developed at Vilnius University, located in Lithuania which was a republic of the Soviet Union at the time. | https://en.wikipedia.org/wiki/Vilnius_BASIC |
| Verilog | Verilog, standardized as IEEE 1364, is a hardware description language (HDL) used to model electronic systems. It is most commonly used in the design and verification of digital circuits at the register-transfer level of abstraction. It is also used in the verification of analog circuits and mixed-signal circuits, as well as in the design of genetic circuits. | https://en.wikipedia.org/wiki/Verilog |
| VML | Vector Markup Language (VML) was an XML-based file format for two-dimensional vector graphics. VML was specified in Part 4 of the Office Open XML standards ISO/IEC 29500 and ECMA-376. According to the specification, VML is a deprecated format included in Office Open XML for legacy reasons only. VML was pervasively used in MS Office 2007 documents (i.e. Word, Excel and PowerPoint documents). As of 2012, with the release of Internet Explorer 10, VML became obsolete and is no longer supported by Internet Explorer standard mode. It is a legacy feature that is available in Internet Explorer 10 only when the browser is set to run in modes that emulate the functionality of previous versions of Internet Explorer 6, 7, 8, and 9. | https://en.wikipedia.org/wiki/Vector_Markup_Language |
| Vala | Vala is an object-oriented programming language with a self-hosting compiler that generates C code and uses the GObject system. Vala is syntactically similar to C# and includes several features such as: anonymous functions, signals, properties, generics, assisted memory management, exception handling, type inference, and foreach statements. Its developers Jürg Billeter and Raffaele Sandrini aim to bring these features to the plain C runtime with little overhead and no special runtime support by targeting the GObject object system. Rather than compiling directly to machine code or assembly language, it compiles to a lower level intermediate language. It source-to-source compiles to C, which is then compiled with a C compiler for a given platform, such as GCC. For memory management, the GObject system provides reference counting. In C, a programmer must manually manage adding and removing references, but in Vala, managing such reference counts is automated if a programmer uses the language's built-in reference types rather than plain pointers. Using functionality from native code libraries requires writing vapi files, defining the library interfacing. Writing these interface definitions is well-documented for C libraries, especially when based on GObject. However, C++ libraries are not supported. Vapi files are provided for a large portion of the GNOME platform, including GTK+. Vala was conceived by Jürg Billeter and was implemented by him and Raffaele Sandrini, finishing a self-hosting compiler in May 2006. | https://en.wikipedia.org/wiki/Vala_(programming_language) |
| VSXu | VSXu (VSX Ultra) is an OpenGL-based (hardware-accelerated), modular programming environment with its main purpose to visualize music/audio data and create 3D effects in real-time. Available for Windows and GNU/Linux. It is currently released as free software under terms of the GNU General Public License v2 and maintained by Vovoid Media Technologies AB. VSXu is built on a modular plug-in-based architecture so anyone can extend it and or make visualization presets ("visuals" or "states"). | https://en.wikipedia.org/wiki/VSXu |
| VRML | VRML (Virtual Reality Modeling Language, pronounced vermal or by its initials, originally—before 1995—known as the Virtual Reality Markup Language) is a standard file format for representing 3-dimensional (3D) interactive vector graphics, designed particularly with the World Wide Web in mind. It has been superseded by X3D. | https://en.wikipedia.org/wiki/VRML |
| VHDL-AMS | VHDL-AMS is a derivative of the hardware description language VHDL (IEEE standard 1076-1993). It includes analog and mixed-signal extensions (AMS) in order to define the behavior of analog and mixed-signal systems (IEEE 1076.1-1999). The VHDL-AMS standard was created with the intent of enabling designers of analog and mixed signal systems and integrated circuits to create and use modules that encapsulate high-level behavioral descriptions as well as structural descriptions of systems and components.VHDL-AMS is an industry standard modeling language for mixed signal circuits. It provides both continuous-time and event-driven modeling semantics, and so is suitable for analog, digital, and mixed analog/digital circuits. It is particularly well suited for verification of very complex analog, mixed-signal and radio frequency integrated circuits. | https://en.wikipedia.org/wiki/VHDL-AMS |
| VHDL | VHDL (VHSIC Hardware Description Language) is a hardware description language used in electronic design automation to describe digital and mixed-signal systems such as field-programmable gate arrays and integrated circuits. VHDL can also be used as a general purpose parallel programming language. | https://en.wikipedia.org/wiki/VHDL |
| VBScript | VBScript ("Microsoft Visual Basic Scripting Edition") is an Active Scripting language developed by Microsoft that is modeled on Visual Basic. It allows Microsoft Windows system administrators to generate powerful tools for managing computers with error handling, subroutines, and other advanced programming constructs. It can give the user complete control over many aspects of their computing environment. VBScript uses the Component Object Model to access elements of the environment within which it is running; for example, the FileSystemObject (FSO) is used to create, read, update and delete files. VBScript has been installed by default in every desktop release of Microsoft Windows since Windows 98; in Windows Server since Windows NT 4.0 Option Pack; and optionally with Windows CE (depending on the device it is installed on). A VBScript script must be executed within a host environment, of which there are several provided with Microsoft Windows, including: Windows Script Host (WSH), Internet Explorer (IE), and Internet Information Services (IIS). Additionally, the VBScript hosting environment is embeddable in other programs, through technologies such as the Microsoft Script Control (msscript.ocx). | https://en.wikipedia.org/wiki/VBScript |
| VAL | VAL may stand for: Variable Assembly Language, a computer-based control system and language designed specifically for use with Unimation Inc. industrial robots Vatican lira, the currency of the Vatican City between 1929 and 2002 Véhicule Automatique Léger, a type of automatic rubber-tired people mover technology Vieques Air Link, an airline | https://en.wikipedia.org/wiki/VAL |
| UNLAMBDA | Unlambda is a minimal, "nearly pure" functional programming language invented by David Madore. It is based on combinatory logic, a version of the lambda calculus that omits the lambda operator. It relies mainly on two built-in functions (s and k) and an apply operator (written `, the backquote character). These alone make it Turing-complete, but there are also some input/output (I/O) functions to enable interacting with the user, some shortcut functions, and a lazy evaluation function. Variables are unsupported. Unlambda is free and open-source software distributed under a GNU General Public License (GPL) 2.0 or later. | https://en.wikipedia.org/wiki/Unlambda |
| UBJSON | Universal Binary JSON (UBJSON) is a computer data interchange format. It is a binary form directly imitating JSON, but requiring fewer bytes of data. It aims to achieve the generality of JSON, combined with being much easier to process than JSON. | https://en.wikipedia.org/wiki/UBJSON |
| Unity | Unity is a cross-platform game engine developed by Unity Technologies, first announced and released in June 2005 at Apple Inc.'s Worldwide Developers Conference as an OS X-exclusive game engine. As of 2018, the engine has been extended to support 27 platforms. The engine can be used to create both three-dimensional and two-dimensional games as well as simulations for its many platforms. Several major versions of Unity have been released since its launch, with the latest stable version being Unity 2018.2.13, released on October 18, 2018. | https://en.wikipedia.org/wiki/Unity_(game_engine) |
| UPC | Unified Parallel C (UPC) is an extension of the C programming language designed for high-performance computing on large-scale parallel machines, including those with a common global address space (SMP and NUMA) and those with distributed memory (e.g. clusters). The programmer is presented with a single shared, partitioned address space, where variables may be directly read and written by any processor, but each variable is physically associated with a single processor. UPC uses a single program, multiple data (SPMD) model of computation in which the amount of parallelism is fixed at program startup time, typically with a single thread of execution per processor. In order to express parallelism, UPC extends ISO C 99 with the following constructs: An explicitly parallel execution model A shared address space Synchronization primitives and a memory consistency model Explicit communication primitives, e.g. upc_memput Memory management primitivesThe UPC language evolved from experiences with three other earlier languages that proposed parallel extensions to ISO C 99: AC, Split-C, and Parallel C preprocessor (PCP). UPC is not a superset of these three languages, but rather an attempt to distill the best characteristics of each. UPC combines the programmability advantages of the shared memory programming paradigm and the control over data layout and performance of the message passing programming paradigm. | https://en.wikipedia.org/wiki/Unified_Parallel_C |
| Uniface | Uniface is a development and deployment platform for enterprise applications that can run in a large range of runtime environments, including mobile, mainframe, web, Service-oriented architecture (SOA), Windows, Java EE and .NET. Uniface is a model-driven, Rapid Application Development (RAD) environment used to create mission-critical applications. Uniface applications are database- and platform-independent. Uniface provides an integration framework that enables Uniface applications to integrate with all major DBMS products such as Oracle, Microsoft SQL Server, MySQL and IBM DB2. In addition, Uniface also supports file systems such as RMS (HP OpenVMS), Sequential files, operating system text files and a wide range of other technologies, such as mainframe-based products (CICS, IMS), web services, SMTP and POP email, LDAP directories, .NET, ActiveX, Component Object Model (COM), C(++) programs, and Java. Uniface operates under Microsoft Windows, Windows Mobile, various flavors of Unix and Linux, VMS, IBM iSeries, and z/OS. Uniface can be used in complex systems that maintain critical enterprise data supporting mission-critical business processes such as point-of sale and web-based online shopping, financial transactions, salary administration, and inventory control. It is currently used by thousands of companies in more than 30 countries, with an effective installed base of millions of end-users. Uniface applications range from client/server to web, and from data entry to workflow, as well as portals that are accessed locally, via intranets and the internet. Originally developed in the Netherlands by Inside Automation, later Uniface B.V., the product and company were acquired by Detroit-based Compuware Corp in 1994, and in 2014 was acquired by Marlin Equity Partners and is now an independent company. Uniface B.V. global headquarters are in Amsterdam. | https://en.wikipedia.org/wiki/Uniface_(programming_language) |
| Unicon | Unicon is a programming language designed by American computer scientist Clint Jeffery with collaborators including Shamim Mohamed, Jafar Al Gharaibeh, Robert Parlett and others. Unicon descended from Icon and a preprocessor for Icon called IDOL. Compared with Icon, Unicon offers better access to the operating system as well as support for object-oriented programming. Unicon began life as a merger of three popular Icon extensions: an OO preprocessor named Idol, a POSIX filesystem and networking interface, and an ODBC facility. The name is shorthand for "Unified Extended Dialect of Icon." Compared with Icon, many of the new features of Unicon are extensions to the I/O and system interface, to complement Icon's core control and data structures. Rather than providing lower-level APIs as-is from C, Unicon implements higher level and easier to use facilities, enabling rapid development of graphic- and network-intensive applications in addition to Icon's core strengths in text and file processing. classes and packages exceptions as a contributed class library - see mailing list loadable child programs monitoring of child programs dynamic loading of C modules (some platforms) multiple inheritance, with novel semantics ODBC database access dbm files can be used as associative arrays posix system interface 3D graphics true concurrency (on platforms supporting Posix threads) When run as a graphical IDE, the Unicon program ui.exe continues to offer links to Icon help. The official Unicon programming book in PDF format is a popular way to learn Unicon. The book includes an introduction to object-oriented development as well as UML. It includes useful chapters on topics such as the use of Unicon for CGI. Recent additions to Unicon include true concurrency. Unicon is not yet Unicode-compliant. There are opportunities posted at a help-wanted page. | https://en.wikipedia.org/wiki/Unicon_(programming_language) |
| Unicode | Unicode is a computing industry standard for the consistent encoding, representation, and handling of text expressed in most of the world's writing systems. The latest version contains a repertoire of 136,755 characters covering 139 modern and historic scripts, as well as multiple symbol sets. The Unicode Standard is maintained in conjunction with ISO/IEC 10646, and both are code-for-code identical. The Unicode Standard consists of a set of code charts for visual reference, an encoding method and set of standard character encodings, a set of reference data files, and a number of related items, such as character properties, rules for normalization, decomposition, collation, rendering, and bidirectional display order (for the correct display of text containing both right-to-left scripts, such as Arabic and Hebrew, and left-to-right scripts). As of June 2017, the most recent version is Unicode 10.0. The standard is maintained by the Unicode Consortium. Unicode's success at unifying character sets has led to its widespread and predominant use in the internationalization and localization of computer software. The standard has been implemented in many recent technologies, including modern operating systems, XML, Java (and other programming languages), and the .NET Framework. Unicode can be implemented by different character encodings. The Unicode standard defines UTF-8, UTF-16, and UTF-32, and several other encodings are in use. The most commonly used encodings are UTF-8, UTF-16 and UCS-2, a precursor of UTF-16. UTF-8, dominantly used by websites (over 90%), uses one byte for the first 128 code points, and up to 4 bytes for other characters. The first 128 Unicode code points are the ASCII characters; so an ASCII text is a UTF-8 text. UCS-2 simply uses two bytes (16 bits) for each character but can only encode the first 65,536 code points, the so-called Basic Multilingual Plane (BMP). With 1,114,112 code points on 17 planes being possible, and with over 120,000 code points defined so far, many Unicode characters are beyond the reach of UCS-2. Therefore, UCS-2 is obsolete, though still widely used in software. UTF-16 extends UCS-2, by using the same 16-bit encoding as UCS-2 for the Basic Multilingual Plane, and a 4-byte encoding for the other planes. As long as it contains no code points in the reserved range U+0D800-U+0DFFF, a UCS-2 text is a valid UTF-16 text. UTF-32 (also referred to as UCS-4) uses four bytes for each character. Like UCS-2, the number of bytes per character is fixed, facilitating character indexing; but unlike UCS-2, UTF-32 is able to encode all Unicode code points. However, because each character uses four bytes, UTF-32 takes significantly more space than other encodings, and is not widely used. | https://en.wikipedia.org/wiki/Unicode |
| Umple | Umple is a language for both object-oriented programming and modelling with class diagrams and state diagrams. The name Umple is a portmanteau of "UML", "ample" and "programming language", indicating that it is designed to provide ample features to extend programming languages with UML capabilities. | https://en.wikipedia.org/wiki/Umple |
| Ubercode | Ubercode is a high level programming language designed by Ubercode Software and released in 2005 for Microsoft Windows. Ubercode is influenced by Eiffel and BASIC. It is commercial software and can be tried out for free for 30 days. Ubercode has the following design goals: Compilable language—compiled into Windows EXE files. Automatic memory management—memory is allocated / freed automatically, and the language has no memory management primitives. Pre and post conditions—these are run-time assertions which are attached to function declarations, as in Eiffel. High-level data types—resizable arrays, lists and tables may contain arbitrary components. Integrated file handling—primitives for transparent handling of text, binary, CSV, XML and dBase files. Ease of use—language structure is relatively simple, making the language accessible to beginners. | https://en.wikipedia.org/wiki/Ubercode |
| UTF-8 | UTF-8 is a variable width character encoding capable of encoding all 1,112,064 valid code points in Unicode using one to four 8-bit bytes. The encoding is defined by the Unicode standard, and was originally designed by Ken Thompson and Rob Pike. The name is derived from Unicode (or Universal Coded Character Set) Transformation Format – 8-bit. It was designed for backward compatibility with ASCII. Code points with lower numerical values, which tend to occur more frequently, are encoded using fewer bytes. The first 128 characters of Unicode, which correspond one-to-one with ASCII, are encoded using a single octet with the same binary value as ASCII, so that valid ASCII text is valid UTF-8-encoded Unicode as well. Since ASCII bytes do not occur when encoding non-ASCII code points into UTF-8, UTF-8 is safe to use within most programming and document languages that interpret certain ASCII characters in a special way, such as "/" in filenames, "\" in escape sequences, and "%" in printf. UTF-8 has been the dominant character encoding for the World Wide Web since 2009, and as of November 2017 accounts for 90.1% of all Web pages. (The next-most popular multibyte encodings, Shift JIS and GB 2312, have 0.8% and 0.6% respectively). The Internet Mail Consortium (IMC) recommended that all e-mail programs be able to display and create mail using UTF-8, and the W3C recommends UTF-8 as the default encoding in XML and HTML. | https://en.wikipedia.org/wiki/UTF-8 |
| UPIC | UPIC (Unité Polyagogique Informatique CEMAMu) is a computerised musical composition tool, devised by the composer Iannis Xenakis. It was developed at the Centre d'Etudes de Mathématique et Automatique Musicales (CEMAMu) in Paris, and was completed in 1977. Xenakis used it on his subsequent piece Mycènes Alpha (1978), and it has been used by composers such as Jean-Claude Risset (on Saxatile (1992)), François-Bernard Mâche (Hypérion (1981), Nocturne (1981), Tithon (1989), Moires (1994), Canopée (2003)), Takehito Shimazu (Illusions in Desolate Fields (1994)), Mari King, and Curtis Roads. Aphex Twin talked about it in an interview Physically, the UPIC is a digitising tablet linked to a computer, which has a vector display. Its functionality is similar to that of the later Fairlight CMI, in that the user draws waveforms and volume envelopes on the tablet, which are rendered by the computer. Once the waveforms have been stored, the user can compose with them by drawing "compositions" on the tablet, with the X-axis representing time, and the Y-axis representing pitch. The compositions can be stretched in duration from a few seconds to an hour. They can also be transposed, reversed, inverted, and subject to a number of algorithmic transformations. The system allows for real time performance by moving the stylus across the tablet. The UPIC system has subsequently been expanded to allow for digitally sampled waveforms as source material, rather than purely synthesised tones. In 2005, Mode Records of New York released a 2-CD compilation of works composed with the UPIC, entitled Xenakis, UPIC, Continuum, which provides an overview of the machine's sonic possibilities. There were a couple of attempts to reproduce the UPIC system using commodity hardware, for instance Iannix, HighC, UPISketch. IanniX, which has been sponsored by the French Ministry of Culture, is a graphical open-source sequencer which syncs via Open Sound Control events and curves to a real-time environment (like Pure Data, SuperCollider, Csound, MaxMSP and openFrameworks among others). For its part, HighC is currently used as a pedagogical tool in classes ranging from early teens to Master classes in composition, while some contemporary composers, such as George Hatzimichelakis have made it part of their toolset. UPISketch is a pedagogical tool inspired by the UPIC. The first version, released in 2018, runs on OSX and iOS. | https://en.wikipedia.org/wiki/UPIC |
| UNITY | UNITY is a programming language constructed by K. Mani Chandy and Jayadev Misra for their book Parallel Program Design: A Foundation. It is a theoretical language which focuses on what, instead of where, when or how. The language contains no method of flow control, and program statements run in a nondeterministic way until statements cease to cause changes during execution. This allows for programs to run indefinitely, such as auto-pilot or power plant safety systems, as well as programs that would normally terminate (which here converge to a fixed point). | https://en.wikipedia.org/wiki/UNITY_(programming_language) |
| UNCOL | UNCOL (Universal Computer Oriented Language) was a proposed universal intermediate language for compilers introduced by Melvin E. Conway in 1958. It was never fully specified or implemented; in many ways it was more a concept than a language. UNCOL was intended to make compilers economically available for each new instruction set architecture and programming language. Each machine architecture would require just one compiler back end, and each programming language would require one compiler front end. This was a very ambitious goal in 1961 because compiler technology was in its infancy, and little was standardized in computer hardware and software. The concept of such a universal intermediate language is old: the SHARE report (1958) already says "[it has] been discussed by many independent persons as long ago as 1954." Macrakis (1993) summarizes its fate: UNCOL was an ambitious effort for the early 1960s. An attempt to solve the compiler-writing problem, it ultimately failed because language and compiler technology were not yet mature. In the 1970s, compiler-compilers ultimately contributed to solving the problem that UNCOL set itself: the economical production of compilers for new languages and new machines. UNCOL is sometimes used as a generic term for the idea of a universal intermediate language. The Architecture Neutral Distribution Format is an example of an UNCOL in this sense. | https://en.wikipedia.org/wiki/UNCOL |
| UIML | UIML (User Interface Markup Language) is an XML-based user interface markup language for defining user interfaces on computers. Basically UIML tries to reduce the work needed to develop user interfaces. It allows you to describe the user interface in declarative terms (i.e. as text) and abstract it. Abstracting means that you don't exactly specify how the user interface is going to look, but rather what elements are to be shown, and how should they behave. For example, to describe a message window, you could write: In theory then you could use that description to generate user interfaces for different platforms, like PDAs. In practice, the different capabilities of those different platforms make a complete translation difficult. Other less ambitious domain-specific programming languages attempt only to describe the user interfaces (or other parts of the application or process) in a domain (for example Windows). See for example the Microsoft language XAML. These languages do a better job usually, but are less flexible. Today, UIML is being standardized by OASIS.A separate effort with the same goals as UIML is UsiXML. | https://en.wikipedia.org/wiki/UIML |
| UCSD Pascal | UCSD Pascal is a Pascal programming language system that runs on the UCSD p-System, a portable, highly machine-independent operating system. UCSD Pascal was first released in 1978. It was developed at the University of California, San Diego (UCSD). | https://en.wikipedia.org/wiki/UCSD_Pascal |
| UBASIC | UBASIC is a freeware (public domain software without source code) BASIC interpreter written by Yuji Kida at Rikkyo University in Japan, specialized for mathematical computing. | https://en.wikipedia.org/wiki/UBASIC |
| Typographical Number Theory | Typographical Number Theory (TNT) is a formal axiomatic system describing the natural numbers that appears in Douglas Hofstadter's book Gödel, Escher, Bach. It is an implementation of Peano arithmetic that Hofstadter uses to help explain Gödel's incompleteness theorems. Like any system implementing the Peano axioms, TNT is capable of referring to itself (it is self-referential). | https://en.wikipedia.org/wiki/Typographical_Number_Theory |
| TypeScript | TypeScript is a free and open-source programming language developed and maintained by Microsoft. It is a strict syntactical superset of JavaScript, and adds optional static typing to the language. Anders Hejlsberg, lead architect of C# and creator of Delphi and Turbo Pascal, has worked on the development of TypeScript. TypeScript may be used to develop JavaScript applications for client-side or server-side (Node.js) execution. TypeScript is designed for development of large applications and compiles to JavaScript. As TypeScript is a superset of JavaScript, existing JavaScript programs are also valid TypeScript programs. TypeScript supports definition files that can contain type information of existing JavaScript libraries, much like C++ header files can describe the structure of existing object files. This enables other programs to use the values defined in the files as if they were statically typed TypeScript entities. There are third-party header files for popular libraries such as jQuery, MongoDB, and D3.js. TypeScript headers for the Node.js basic modules are also available, allowing development of Node.js programs within TypeScript. The TypeScript compiler is itself written in TypeScript and compiled to JavaScript. It is licensed under the Apache 2 License. TypeScript is included as a first-class programming language in Microsoft Visual Studio 2013 Update 2 and later, beside C# and other Microsoft languages. An official extension allows Visual Studio 2012 to support TypeScript as well. | https://en.wikipedia.org/wiki/TypeScript |
| Tynker | Tynker is an educational programming platform aimed at teaching children how to make games and programs. Instead of typing the source code, you visually drag blocks of code and snap them together. The visual design and principles are based on the free Scratch, just like Hopscotch and Snap!. Tynker is based on HTML5 and JavaScript, and can be used in the browser without plugins, as well as on tablets and smartphones. Another difference is that Scratch is a free open source project, while Tynker is a commercial product, aimed at selling courses. Tynker offers self-paced online courses for children to learn coding at home, as well as an engaging programming curriculum for schools and camps. It makes it easier for kids to learn coding as it teaches kids coding through creating games like Minecraft, Hour of Code etc. | https://en.wikipedia.org/wiki/Tynker |
| Tymshare SuperBasic | Tymshare, Inc. was a time-sharing service and third-party hardware maintenance company competing with companies such as Four-Phase Systems, CompuServe, and Digital Equipment Corporation (DEC, Digital). Tymshare developed or acquired innovative technologies, including data networking (Tymnet), electronic data interchange (EDI), credit card and payment processing (Transaction Tracking System, Western29), telecommunications provisioning (COEES), office automation (August, Augment) and database technology (Magnum). It was headquartered in Cupertino, California from 1964 to 1984. The computing platforms included the SDS 940, XDS 940 (Tymcom-IX), XDS Sigma 7, DEC PDP-10 models KA, KI, KL and KS (Tymcom-X/XX, Tenex, August, Tops-20), XKL Toad-1, IBM 360 & 370 (VM, MVS, GNOSIS) servers. Divisions: INSD — Information Services Division STD — Systems Technology Division DND — Data Networks DivisionIn 1984 Tymshare was acquired by McDonnell Douglas, restructured, split up and portions were resold, spun off, and merged with other companies from 1984 through 2004 when most of its legacy network was finally shut down. Islands of its network technology continued as part of EDI, at least into 2008. McDonnell Douglas was acquired by Boeing. Consequently, rights to use technology developed by Tymshare are currently held by Boeing, British Telecom (BT), Verizon Communications, and AT&T Inc. due to the acquisitions and mergers from 1984 through 2005. | https://en.wikipedia.org/wiki/Tymshare_SuperBasic |
| Twig | Twig is a template engine for the PHP programming language. Its syntax originates from Jinja and Django templates. It's an open source product licensed under a BSD License and maintained by Fabien Potencier. The initial version was created by Armin Ronacher. Symfony2 PHP framework comes with a bundled support for Twig as its default template engine. | https://en.wikipedia.org/wiki/Twig_(template_engine) |
| Twelf | Twelf is an implementation of the logical framework LF developed by Frank Pfenning and Carsten Schürmann at Carnegie Mellon University . It is used for logic programming and for the formalization of programming language theory. | https://en.wikipedia.org/wiki/Twelf |
| Turing | Turing is a Pascal-like programming language developed in 1982 by Ric Holt and James Cordy, then of University of Toronto, Canada. Turing is a descendant of Euclid, Pascal and SP/k that features a clean syntax and precise machine-independent semantics. Turing 4.1.0 is the latest stable version of Turing. Turing 4.1.1 and Turing 4.1.2 do not allow for stand alone .EXE files to be created and versions before Turing 4.1.0 have outdated syntax and outdated functions. | https://en.wikipedia.org/wiki/Turing_(programming_language) |
| Turbo Pascal | Turbo Pascal is a software development system that includes a compiler and an integrated development environment (IDE) for the Pascal programming language running on CP/M, CP/M-86, and MS-DOS, developed by Borland under Philippe Kahn's leadership. For versions 6 and 7 (last), both a lower-priced Turbo Pascal and more expensive Borland Pascal were produced; Borland Pascal was more oriented towards professional software development, with more libraries and standard library source code. The name Borland Pascal is also used more generically for Borland's dialect of the Pascal programming language, significantly different from Standard Pascal. Borland has released three old versions of Turbo Pascal free of charge because of their historical interest: the original Turbo Pascal (now known as 1.0), and versions 3.02 and 5.5 for DOS. | https://en.wikipedia.org/wiki/Turbo_Pascal |
| Turbo Assembler | Turbo Assembler (TASM) is a computer assembler (software for program development) developed by Borland which runs on and produces code for 16- or 32-bit x86 DOS or Microsoft Windows. It can be used with Borland's high-level language compilers, such as Turbo Pascal, Turbo Basic, Turbo C and Turbo C++. The Turbo Assembler package is bundled with the Turbo Linker, and is interoperable with the Turbo Debugger. TASM can assemble Microsoft Macro Assembler (MASM) source using its MASM mode and has an ideal mode with a few enhancements. Object-Oriented programming has been supported since version 3.0. The last version of Turbo Assembler is 5.4, with files dated 1996 and patches up to 2010; it is still supplied with Delphi and C++Builder. TASM itself is a 16-bit program; it will run on 16- and 32-bit versions of Windows, and produce code for the same versions. There are ways to run 16-bit programs such as TASM on 64-bit Windows (e.g., on a virtual machine), but it will not generate 64-bit Windows code. The Borland Turbo Assembler 5.0 package is supplied on three 3.5-inch diskettes and with three small books. | https://en.wikipedia.org/wiki/Turbo_Assembler |
| True BASIC | True BASIC is a variant of the BASIC programming language descended from Dartmouth BASIC — the original BASIC — invented by college professors John G. Kemeny and Thomas E. Kurtz. | https://en.wikipedia.org/wiki/True_BASIC |
| TriG syntax | TriG is a serialization format for RDF (Resource Description Framework) graphs. It is a plain text format for serializing named graphs and RDF Datasets which offers a compact and readable alternative to the XML-based TriX syntax. | https://en.wikipedia.org/wiki/TriG_(syntax) |
| Trellis | Trellis may refer to: | https://en.wikipedia.org/wiki/Trellis |
| Treelang | Treelang is a "toy" programming language distributed with the GNU Compiler Collection (GCC) to demonstrate the features of its code-generation backend. It was developed by Tim Josling, based on a language called Toy created by Richard Kenner. During the GCC 4.3 release cycle, a patch was committed to remove the language, because of high maintenance costs outweighing its benefits and also because it was no longer considered a good front-end example by GCC developers. | https://en.wikipedia.org/wiki/Treelang |
| TLS | Transport Layer Security (TLS) and its predecessor, Secure Sockets Layer (SSL), are cryptographic protocols that provide communications security over a computer network. Several versions of the protocols find widespread use in applications such as web browsing, email, Internet faxing, instant messaging, and Voice over IP (VoIP). Websites are able to use TLS to secure all communications between their servers and web browsers. The Transport Layer Security protocol aims primarily to provide privacy and data integrity between two communicating computer applications. When secured by TLS, connections between a client (e.g., a web browser) and a server (e.g., wikipedia.org) have one or more of the following properties: The connection is private (or secure) because symmetric cryptography is used to encrypt the data transmitted. The keys for this symmetric encryption are generated uniquely for each connection and are based on a shared secret negotiated at the start of the session (see § TLS handshake). The server and client negotiate the details of which encryption algorithm and cryptographic keys to use before the first byte of data is transmitted (see § Algorithm below). The negotiation of a shared secret is both secure (the negotiated secret is unavailable to eavesdroppers and cannot be obtained, even by an attacker who places themselves in the middle of the connection) and reliable (no attacker can modify the communications during the negotiation without being detected). The identity of the communicating parties can be authenticated using public-key cryptography. This authentication can be made optional, but is generally required for at least one of the parties (typically the server). The connection ensures integrity because each message transmitted includes a message integrity check using a message authentication code to prevent undetected loss or alteration of the data during transmission. In addition to the properties above, careful configuration of TLS can provide additional privacy-related properties such as forward secrecy, ensuring that any future disclosure of encryption keys cannot be used to decrypt any TLS communications recorded in the past. TLS supports many different methods for exchanging keys, encrypting data, and authenticating message integrity (see § Algorithm below). As a result, secure configuration of TLS involves many configurable parameters, and not all choices provide all of the privacy-related properties described in the list above (see the § Key exchange (authentication), § Cipher security, and § Data integrity tables). Attempts have been made to subvert aspects of the communications security that TLS seeks to provide and the protocol has been revised several times to address these security threats (see § Security). Developers of web browsers have also revised their products to defend against potential security weaknesses after these were discovered (see TLS/SSL support history of web browsers). The TLS protocol comprises two layers: the TLS record and the TLS handshake protocols. TLS is a proposed Internet Engineering Task Force (IETF) standard, first defined in 1999 and updated in RFC 5246 (August 2008) and RFC 6176 (March 2011). It builds on the earlier SSL specifications (1994, 1995, 1996) developed by Netscape Communications for adding the HTTPS protocol to their Navigator web browser. | https://en.wikipedia.org/wiki/Transport_Layer_Security |
| Transaction Language 1 | Transaction Language 1 (TL1) is a widely used management protocol in telecommunications. It is a cross-vendor, cross-technology man-machine language, and is widely used to manage optical (SONET) and broadband access infrastructure in North America. TL1 is used in the input and output messages that pass between Operations Support Systems (OSSs) and Network Elements (NEs). Operations domains such as surveillance, memory administration, and access and testing define and use TL1 messages to accomplish specific functions between the OS and the NE. TL1 is defined in Telcordia Technologies (formerly Bellcore) Generic Requirements document GR-831-CORE. | https://en.wikipedia.org/wiki/Transaction_Language_1 |
| TAL | Transaction Application Language or TAL (originally "Tandem Application Language") is a block-structured, procedural language optimized for use on Tandem hardware. TAL resembles a cross between C and Pascal. It was the original system programming language for the Tandem CISC machines, which had no assembler. The design concept of TAL, an evolution of Hewlett Packard's SPL, was intimately associated and optimized with a microprogrammed CISC instruction set. Each TAL statement could easily compile into a sequence of instructions that manipulated data on a transient floating register stack. The register stack itself floated at the crest of the program's memory allocation and call stack. The language itself has the appearance of ALGOL or Pascal, with BEGIN and END statements. However, its semantics are far more like C. It does not permit indefinite levels of procedure nesting, it does not pass complex structured arguments by value, and it does not strictly type most variable references. Programming techniques are much like C using pointers to structures, occasional overlays, deliberate string handling and casts when appropriate. Available datatypes include 8 bit, 16 bit, 32 bit and (introduced later) 64 bit integers. Microcode level support was available for null terminated character strings. However, this is not commonly used. Originally the Tandem NonStop operating system was written in TAL. Recently much of it has been rewritten in C and TAL has been deprecated for new development. In the migration from CISC to RISC TAL was updated/replaced with pTAL - compilers allowed TAL to be accelerated/re-compiled into Native RISC Applications. In the current migration from RISC to Intel Itanium 2 TAL and pTAL has been replaced with epTAL, again - compilers allow TAL and pTAL code to be accelerated/re-compiled into native Itanium Applications. This article is based on material taken from the Free On-line Dictionary of Computing prior to 1 November 2008 and incorporated under the "relicensing" terms of the GFDL, version 1.3 or later. | https://en.wikipedia.org/wiki/Transaction_Application_Language |
| Transact-SQL | Transact-SQL (T-SQL) is Microsoft's and Sybase's proprietary extension to the SQL (Structured Query Language) used to interact with relational databases. T-SQL expands on the SQL standard to include procedural programming, local variables, various support functions for string processing, date processing, mathematics, etc. and changes to the DELETE and UPDATE statements. Transact-SQL is central to using Microsoft SQL Server. All applications that communicate with an instance of SQL Server do so by sending Transact-SQL statements to the server, regardless of the user interface of the application. | https://en.wikipedia.org/wiki/Transact-SQL |
| ToonTalk | ToonTalk is a computer programming system intended to be programmed by children. The "Toon" part stands for cartoon. The system's presentation is in the form of animated characters, including robots that can be trained by example. It is one of the few successful implementations outside academia of the concurrent constraint logic programming paradigm. It was created by Kenneth M. Kahn in 1995, and implemented as part of the ToonTalk IDE, a software package distributed worldwide between 1996 and 2009. Since 2009, its specification is scholarly published and its implementation is freely available. Beginning 2014 a JavaScript HTML5 version of ToonTalk called ToonTalk Reborn for the Web has been available. It runs on any modern web browser and differs from the desktop version of ToonTalk in a few ways. ToonTalk programs can run on any DOM element and various browser capabilities (audio, video, style sheets, speech input and output, and browser events) are available to ToonTalk programs. Web services such as Google Drive are integrated. ToonTalk Reborn is free and open source. Beyond its life as a commercial product, ToonTalk evolved via significant academic use in various research projects, notably at the London Knowledge Lab and the Institute of Education - projects Playground and WebLabs, which involved research partners from Cambridge (Logotron), Portugal (Cnotinfor and the University of Lisbon), Sweden (Royal Institute of Technology), Slovakia (Comenius University), Bulgaria (Sofia University), Cyprus (University of Cyprus), and Italy (Institute for Educational Technology of the Consiglio Nazionale delle Ricerche). It was also source of academic interest in Sweden, where Mikael Kindborg proposed a static representation of ToonTalk programs and in Portugal, where Leonel Morgado studied its potential to enable computer programming by preliterate children.ToonTalk was influenced by the Janus computer programming language and the Actor model. The main communication abstraction in ToonTalk is the bird/nest pair. When you (the programmer or a robot) give a thing to a bird, she flies to her nest and puts the thing in it, then returns. If one or more things already occupy the nest, the bird puts the new one underneath the others. A ToonTalk program is a sequence of rules, where each rule has a head and a tail. The head is a pattern that can be matched against the argument, which must be a tuple. In ToonTalk's presentation, a rule appears as a robot, a program as a team of robots, and a tuple as a box that can have any number of holes or compartments in which things may be placed. The alphabet of things includes number pads, text pads, other boxes, robot teams, birds, nests, and things from some other categories. A process consists of a box with a team of robots working on it. If none of the patterns matches the box, the process suspends. Otherwise, the first rule that matches, fires. The end of the tail of the rule can either destroy the process, or continue it with the same team. In case the pattern calls for something other than an empty nest where an empty nest is present, the process suspends until some bird should place something on the nest (usually as a result of the actions of other processes). A nest with something on it matches the pattern as though the nest were not there, just the (top) something. The actions in the tail also manipulate the something rather than the whole nest. Consequently, a nest can be used to program a future. ToonTalk can be given an imperative reading or a declarative reading. If we ignore certain constructs designed to facilitate I/O, we can see ToonTalk as not having any shared access to mutable memory. The bird/nest mechanism resembles the communication in the Actor model, but with the additional power to be able to pass nests around and for a process to hold more than one nest (which is also true in Janus). A difference between communication in the Actor model and in ToonTalk is that ToonTalk preserves the order of the messages; however, ToonTalk can also provide an indeterministic merge of message streams. | https://en.wikipedia.org/wiki/ToonTalk |
| TOM | Tom is a programming language particularly well-suited for programming various transformations on tree structures and XML based documents. Tom is a language extension which adds new matching primitives to C and Java as well as support for rewrite rules systems. The rules can be controlled using a strategy language. Tom is good for: programming by pattern matching developing compilers and DSL transforming XML documents implementing rule based systems describing algebraic transformations | https://en.wikipedia.org/wiki/Tom_(pattern_matching_language) |
| Toi | Toi is an imperative, type-sensitive language that provides the basic functionality of a programming language. The language was designed and developed from the ground-up by Paul Longtine. Written in C, Toi was created with the intent to be an educational experience and serves as a learning tool (or toy, hence the name) for those looking to familiarize themselves with the inner-workings of a programming language. | https://en.wikipedia.org/wiki/Toi_(programming_language) |
| Multi-User Forth | TinyMUCK or, more broadly, a MUCK, is a type of user-extendable online text-based role-playing game, designed for role playing and social interaction. Backronyms like "Multi-User Chat/Created/Computer/Character/Carnal Kingdom" and "Multi-User Construction Kit" are sometimes cited, but are not the actual origin of the term; "muck" is simply a play on the term MUD. | https://en.wikipedia.org/wiki/MUF_(programming_language) |
| Tiny BASIC | Tiny BASIC is a dialect of the BASIC programming language that can fit into as little as 2 or 3 KB of memory. This small size made it invaluable in the early days of microcomputers in the mid-1970s, when typical memory size was only 4 to 8 KB. To meet these strict size limits, math was purely integer based and it lacked arrays. The language was written, in part, as an alternative to Microsoft BASIC. MS BASIC would also run in 4 KB machines, but left only 790 bytes free for the programs. More free space was a significant advantage of Tiny BASIC. Piracy of MS BASIC led Bill Gates to publish an open letter complaining about people "stealing" BASIC, which further helped drive the popularity of this alternative. Tiny BASIC was published in a newsletter offshoot of the People's Computer Company. Dozens of versions were created for almost every platform of the era, and there were many variations and additions that were published over time. The newsletter eventually became Dr. Dobb's Journal, a long-lived computing magazine. Tiny BASIC is an example of a free software project that existed before the free software movement. | https://en.wikipedia.org/wiki/Tiny_BASIC |
| Tiger-BASIC | Tiger-BASIC is a high speed multitasking BASIC dialect (List of BASIC dialects) to program microcontrollers of the BASIC-Tiger family. Tiger-BASIC and the integrated development environment which goes with it, were developed by Wilke-Technology (Aachen, Germany). | https://en.wikipedia.org/wiki/Tiger-BASIC |
| TiddlyWiki | TiddlyWiki is an open-source single page application wiki in the form of a single HTML file that includes CSS, JavaScript, and the content. It is designed to be easy to customize and re-shape depending on application. It facilitates re-use of content by dividing it into small pieces called Tiddlers. | https://en.wikipedia.org/wiki/TiddlyWiki |
| Thymeleaf | Thymeleaf is a Java XML/XHTML/HTML5 template engine that can work both in web (servlet-based) and non-web environments. It is better suited for serving XHTML/HTML5 at the view layer of MVC-based web applications, but it can process any XML file even in offline environments. It provides full Spring Framework integration. In web applications Thymeleaf aims to be a complete substitute for JavaServer Pages (JSP), and implements the concept of Natural Templates: template files that can be directly opened in browsers and that still display correctly as web pages. Thymeleaf is Open-Source Software, licensed under the Apache License 2.0. | https://en.wikipedia.org/wiki/Thymeleaf |
| Thue | Thue ( TOO-ay) is an esoteric programming language invented by John Colagioia in early 2000. It is a meta-language that can be used to define or recognize Type-0 languages from the Chomsky hierarchy. Because it is able to define languages of such complexity, it is also Turing-complete itself. Thue is based on a nondeterministic string rewriting system called semi-Thue grammar, which itself is named after the Norwegian mathematician Axel Thue. The author describes it as follows: "Thue represents one of the simplest possible ways to construe constraint-based programming. It is to the constraint-based paradigm what languages like OISC are to the imperative paradigm; in other words, it's a tar pit." | https://en.wikipedia.org/wiki/Thue_%28programming_language%29 |
| Thrift | Thrift is an interface definition language and binary communication protocol that is used to define and create services for numerous languages. It is used as a remote procedure call (RPC) framework and was developed at Facebook for "scalable cross-language services development". It combines a software stack with a code generation engine to build cross-platform services that can connect applications written in a variety of languages and frameworks, including ActionScript, C, C++, C#, Cappuccino, Cocoa, Delphi, Erlang, Go, Haskell, Java, Node.js, Objective-C, OCaml, Perl, PHP, Python, Ruby and Smalltalk. Although developed at Facebook, it is now an open source project in the Apache Software Foundation. The implementation was described in an April 2007 technical paper released by Facebook, now hosted on Apache. | https://en.wikipedia.org/wiki/Apache_Thrift |
| Simons' BASIC | This product is widely, but incorrectly, called "Simon's BASIC", because of confusion between the first name "Simon" and the surname "Simons".Simons' BASIC was an extension to BASIC 2.0 for the Commodore 64 home computer. Written by 16-year-old British programmer David Simons in 1983, it was distributed by Commodore in cartridge format. | https://en.wikipedia.org/wiki/Simons%27_BASIC |
| Bywater BASIC | This is an alphabetical list of BASIC dialects—interpreted and compiled variants of the BASIC programming language. Each dialect's platform(s), i.e., the computer models and operating systems, are given in parentheses along with any other significant information. | https://en.wikipedia.org/wiki/Bywater_BASIC |
| Executive Systems Problem Oriented Language | This article is about the programming language. For the university, see Escuela Superior Politecnica del Litoral.ESPOL (short for Executive Systems Problem Oriented Language) was a superset of ALGOL 60 that provided capabilities of what would later be known as Mohols, machine oriented high order languages, such as interrupting a processor on a multiprocessor system (the Burroughs large systems were multiprocessor processor systems). ESPOL was used to write the MCP (Master Control Program) on Burroughs computer systems from the B5000 to the B6700. The single-pass compiler for ESPOL could compile over 250 lines per second. ESPOL was superseded by NEWP. | https://en.wikipedia.org/wiki/Executive_Systems_Problem_Oriented_Language |
| Turbo-Basic XL | This article is about the language for Atari 8-bit computers. Not to be confused with Borland's unrelated Turbo Basic.Turbo-Basic XL is an advanced version of BASIC for the Atari 8-bit family of home computers. It is a compatible superset of the Atari BASIC that was built-in to most Atari machines of the era. Turbo-Basic XL's most notable feature was vastly improved execution speed. An Atari BASIC program loaded into Turbo-BASIC, with no changes made, would generally run about three times as fast. A Turbo-Basic XL compiler was also available that created binary executables, further speeding up program performance to about ten times faster than Atari BASIC. Turbo-Basic XL was developed by Frank Ostrowski and published in the December 1985 issue of German computer magazine Happy Computer. A version for the 400/800 models was released shortly after, known as Frost Basic 1.4. | https://en.wikipedia.org/wiki/Turbo-Basic_XL |
| Amigas | This article deals with programming languages used in the Amiga line of computers, running the AmigaOS operating system and its derivatives AROS and MorphOS. It is a split of the main article Amiga software. See also related articles Amiga productivity software, Amiga music software, Amiga Internet and communications software and Amiga support and maintenance software for other information regarding software that runs on Amiga. | https://en.wikipedia.org/wiki/Amiga_programming_languages |
| ThingLab | ThingLab is a visual programming environment implemented in Smalltalk and designed at Xerox PARC by Alan Borning. A conventional system allows a user to provide inputs that produce outputs. A constraint-oriented system, such as ThingLab, allows the user to provide arbitrary inputs or outputs, then solves for whatever is unknown. ThingLab is viewed as one of the earliest constraint-oriented systems.ThingLab is credited in "Fumbling the Future" as a big reason Xerox continued to fund computer development. | https://en.wikipedia.org/wiki/ThingLab |
| Ternary numeral system | The ternary numeral system (also called base 3) has three as its base. Analogous to a bit, a ternary digit is a trit (trinary digit). One trit is equivalent to log2 3 (about 1.58496) bits of information. Although ternary most often refers to a system in which the three digits are all non–negative numbers, specifically 0, 1, and 2, the adjective also lends its name to the balanced ternary system, comprising the digits −1, 0 and +1, used in comparison logic and ternary computers. | https://en.wikipedia.org/wiki/Ternary_numeral_system |
| GARP | The term or acronym GARP can refer to: Generic Attribute Registration Protocol, a communications protocol Genetic Algorithm for Rule Set Production, to determine ecological niches Global Atmospheric Research Programme, 1967-1982 Gratuitous Address Resolution ProtocolOr it could refer to the following fictional works or characters: Monkey D. Garp, a character in the Japanese anime One Piece The World According to Garp, a 1978 novel by John Irving The World According to Garp (film), a 1982 film based on Irving's novel | https://en.wikipedia.org/wiki/GARP |
| Information Algebra | The term "information algebra" refers to mathematical techniques of information processing. Classical information theory goes back to Claude Shannon. It is a theory of information transmission, looking at communication and storage. However, it has not been considered so far that information comes from different sources and that it is therefore usually combined. It has furthermore been neglected in classical information theory that one wants to extract those parts out of a piece of information that are relevant to specific questions. A mathematical phrasing of these operations leads to an algebra of information, describing basic modes of information processing. Such an algebra involves several formalisms of computer science, which seem to be different on the surface: relational databases, multiple systems of formal logic or numerical problems of linear algebra. It allows the development of generic procedures of information processing and thus a unification of basic methods of computer science, in particular of distributed information processing. Information relates to precise questions, comes from different sources, must be aggregated, and can be focused on questions of interest. Starting from these considerations, information algebras (Kohlas 2003) are two-sorted algebras ( Φ , D ) {\displaystyle (\Phi ,D)\,} , where Φ {\displaystyle \Phi \,} is a semigroup, representing combination or aggregation of information, D {\displaystyle D\,} is a lattice of domains (related to questions) whose partial order reflects the granularity of the domain or the question, and a mixed operation representing focusing or extraction of information. | https://en.wikipedia.org/wiki/Information_algebra |
| Tap code | The tap code, sometimes called the knock code, is a way to encode text messages on a letter-by-letter basis in a very simple way. The message is transmitted using a series of tap sounds, hence its name. The tap code has been commonly used by prisoners to communicate with each other. The method of communicating is usually by tapping either the metal bars, pipes or the walls inside a cell. | https://en.wikipedia.org/wiki/Tap_code |
| Smiles | The simplified molecular-input line-entry system (SMILES) is a specification in the form of a line notation for describing the structure of chemical species using short ASCII strings. SMILES strings can be imported by most molecule editors for conversion back into two-dimensional drawings or three-dimensional models of the molecules. The original SMILES specification was initiated in the 1980s. It has since been modified and extended. In 2007, an open standard called OpenSMILES was developed in the open-source chemistry community. Other linear notations include the Wiswesser line notation (WLN), ROSDAL, and SYBYL Line Notation (SLN). | https://en.wikipedia.org/wiki/Simplified_molecular-input_line-entry_system |
| Shapefile | The shapefile format is a popular geospatial vector data format for geographic information system (GIS) software. It is developed and regulated by Esri as a (mostly) open specification for data interoperability among Esri and other GIS software products. The shapefile format can spatially describe vector features: points, lines, and polygons, representing, for example, water wells, rivers, and lakes. Each item usually has attributes that describe it, such as name or temperature. | https://en.wikipedia.org/wiki/Shapefile |
| Pan | The pan configuration language allows the definition of machine configuration information and an associated schema with a simple, human-accessible syntax. A pan language compiler transforms the configuration information contained within a set of pan templates to a machine-friendly XML or JSON format. The pan language is used within the Quattor toolkit to define the desired configuration for one or more machines. The language is primarily a declarative language where elements in a hierarchical tree are set to particular values. The pan syntax is human-friendly and fairly simple, yet allows system administrators to simultaneously set configuration values, define an overall configuration schema, and validate the final configuration against the schema. | https://en.wikipedia.org/wiki/Pan_(programming_language) |
| Memex | The memex (originally coined "at random", though sometimes said to be a portmanteau of "memory" and "index") is the name of the hypothetical proto-hypertext system that Vannevar Bush described in his 1945 The Atlantic Monthly article "As We May Think". Bush envisioned the memex as a device in which individuals would compress and store all of their books, records, and communications, "mechanized so that it may be consulted with exceeding speed and flexibility". The memex would provide an "enlarged intimate supplement to one's memory". The concept of the memex influenced the development of early hypertext systems (eventually leading to the creation of the World Wide Web) and personal knowledge base software. The hypothetical implementation depicted by Bush for the purpose of concrete illustration was based upon a document bookmark list of static microfilm pages and lacked a true hypertext system, where parts of pages would have internal structure beyond the common textual format. Early electronic hypertext systems were thus inspired by memex rather than modeled directly upon it. | https://en.wikipedia.org/wiki/Memex |
| MIRC scripting language | The mIRC scripting language, often unofficially abbreviated to "mSL", is the scripting language embedded in mIRC, an IRC client for Windows. | https://en.wikipedia.org/wiki/MIRC_scripting_language |
| General feature format | The general feature format (gene-finding format, generic feature format, GFF) is a file format used for describing genes and other features of DNA, RNA and protein sequences. The filename extension associated with such files is .GFF and the content type associated with them is text/x-gff3. There are two versions of the GFF file format in general use: General Feature Format Version 2.2 especially in its GTF variant Generic Feature Format Version 3 (Sequence Ontology Project)Servers that generate this format: Clients that use this format: | https://en.wikipedia.org/wiki/General_feature_format |
| fish | The friendly interactive shell (fish) is a Unix shell that attempts to be more interactive and user-friendly than those with a longer history (i.e. most other Unix shells) or those formulated as function-compatible replacements for the aforementioned (e.g. zsh, the Falstad shell). The design goal of fish is to give the user a rich set of powerful features in a way that is easy to discover, remember, and use. fish is considered an "exotic shell", in that its syntax derives from neither the Bourne shell (ksh, bash, zsh) nor the C shell (csh, tcsh). Also unlike previous shells, which disable certain features by default to save system resources, fish enables all features by default. | https://en.wikipedia.org/wiki/Friendly_interactive_shell |
| Extended file system | The extended file system, or ext, was implemented in April 1992 as the first file system created specifically for the Linux kernel. It has metadata structure inspired by the traditional Unix File System (UFS) and was designed by Rémy Card to overcome certain limitations of the MINIX file system. It was the first implementation that used the virtual file system (VFS), for which support was added in the Linux kernel in version 0.96c, and it could handle file systems up to 2 gigabytes (GB) in size.ext was the first in the series of extended file systems. In 1993 it was superseded by both ext2 and xiafs, which competed for a time, but ext2 won because of its long-term viability: ext2 remedied issues with ext, such as the immutability of inodes and fragmentation. | https://en.wikipedia.org/wiki/Extended_file_system |
| Ext4 | The ext4 or fourth extended filesystem is a journaling file system for Linux, developed as the successor to ext3. | https://en.wikipedia.org/wiki/Ext4 |
| Ext2 | The ext2 or second extended file system is a file system for the Linux kernel. It was initially designed by Rémy Card as a replacement for the extended file system (ext). Having been designed according to the same principles as the Berkeley Fast File System from BSD, it was the first commercial-grade filesystem for Linux.The canonical implementation of ext2 is the "ext2fs" filesystem driver in the Linux kernel. Other implementations (of varying quality and completeness) exist in GNU Hurd, MINIX 3, some BSD kernels, in MiNT, and as third-party Microsoft Windows and macOS drivers. ext2 was the default filesystem in several Linux distributions, including Debian and Red Hat Linux, until supplanted more recently by ext3, which is almost completely compatible with ext2 and is a journaling file system. ext2 is still the filesystem of choice for flash-based storage media (such as SD cards and USB flash drives) because its lack of a journal increases performance and minimizes the number of writes, and flash devices have a limited number of write cycles. However, recent Linux kernels support a journal-less mode of ext4 which provides benefits not found with ext2. | https://en.wikipedia.org/wiki/Ext2 |
| CLX | The acronym CLX can refer to a number of things: 160 in Roman numerals Cargolux, an airline using the ICAO code CLX CLX (Common Lisp), a Common Lisp computer library CLX Communications, a telecommunications and cloud communications platform as a service company, based in Stockholm, Sweden Component Library for Cross Platform (CLX), a cross-platform visual component-based framework | https://en.wikipedia.org/wiki/CLX |
| Z-machine | The Z-machine is a virtual machine that was developed by Joel Berez and Marc Blank in 1979 and used by Infocom for its text adventure games. Infocom compiled game code to files containing Z-machine instructions (called story files or Z-code files) and could therefore port its text adventures to a new platform simply by writing a Z-machine implementation for that platform. With the large number of incompatible home computer systems in use at the time, this was an important advantage over using native code or developing a compiler for each system. | https://en.wikipedia.org/wiki/Z-machine |
| Z shell | The Z shell (Zsh) is a Unix shell that can be used as an interactive login shell and as a powerful command interpreter for shell scripting. Zsh is an extended Bourne shell with a large number of improvements, including some features of Bash, ksh, and tcsh. | https://en.wikipedia.org/wiki/Z_shell |
| Z notation | The Z notation is a formal specification language used for describing and modelling computing systems. It is targeted at the clear specification of computer programs and computer-based systems in general. | https://en.wikipedia.org/wiki/Z_notation |
| Yum | The Yellowdog Updater, Modified (YUM) is a libre and open-source command-line package-management utility for computers running the Linux operating system using the RPM Package Manager. Though YUM has a command-line interface, several other tools provide graphical user interfaces to YUM functionality. YUM allows for automatic updates and package and dependency management on RPM-based distributions. Like the Advanced Package Tool (APT) from Debian, YUM works with software repositories (collections of packages), which can be accessed locally or over a network connection. Under the hood, YUM depends on RPM, which is a packaging standard for digital distribution of software, which automatically uses hashes and digisigs to verify the authorship and integrity of said software; unlike some app stores, which serve a similar function, neither YUM nor RPM provide built-in support for proprietary restrictions on copying of packages by end-users. YUM is implemented as libraries in the Python programming language, with a small set of programs that provide a command-line interface. GUI-based wrappers such as YUM Extender (yumex) also exist.A rewrite of YUM named DNF replaced YUM as the default package manager in Fedora 22. DNF was created to improve on YUM in several ways - improved performance, better resolution of dependency conflicts, and easier integration with other software applications. | https://en.wikipedia.org/wiki/Yum_(software) |
| Xojo | The Xojo programming environment is developed and commercially marketed by Xojo, Inc. of Austin, Texas for software development targeting macOS, Microsoft Windows, Linux, iOS, the Web and Raspberry Pi. Xojo uses a proprietary object-oriented BASIC dialect, also known as Xojo. | https://en.wikipedia.org/wiki/Xojo |
| XML Metadata Interchange | The XML Metadata Interchange (XMI) is an Object Management Group (OMG) standard for exchanging metadata information via Extensible Markup Language (XML). It can be used for any metadata whose metamodel can be expressed in Meta-Object Facility (MOF). The most common use of XMI is as an interchange format for UML models, although it can also be used for serialization of models of other languages (metamodels). | https://en.wikipedia.org/wiki/XML_Metadata_Interchange |
| XBEL | The XML Bookmark Exchange Language (XBEL), is an open XML standard for sharing Internet URIs, also known as bookmarks (or favorites in Internet Explorer). An example of XBEL use is the XBELicious application, which stores Del.icio.us bookmarks in XBEL format. The Galeon, Konqueror, Arora and Midori web browsers use XBEL as the format for storing user bookmarks. The SiteBar bookmark server can import and export bookmarks in XBEL format. XBEL was created by the Python XML Special Interest Group "to create an interesting, fun project which was both useful and would demonstrate the Python XML processing software which was being developed at the time".It is also used by Nautilus and gedit of the GNOME desktop environment. | https://en.wikipedia.org/wiki/XBEL |
| XCore Architecture | The XCore Architecture is a 32-bit RISC microprocessor architecture designed by XMOS. The architecture is designed to be used in multi-core processors for embedded systems. Each XCore executes up to eight concurrent threads, each thread having its own register set, and the architecture directly supports inter-thread and inter-core communication and various forms of thread scheduling. Two versions of the XCore architecture exist: the XS1 architecture and the XS2 architecture. Processors with the XS1 architecture include the XCore XS1-G4 and XCore XS1-L1. Processors with the XS2 architecture include xCORE-200. The architecture encodes instructions compactly, using 16 bits for frequently used instructions (with up to three operands) and 32 bits for less frequently used instructions (with up to 6 operands). Almost all instructions execute in a single cycle, and the architecture is event-driven in order to decouple the timings that a program needs to make from the execution speed of the program. A program will normally perform its computations and then wait for an event (e.g. a message, time, or external I/O event) before continuing. | https://en.wikipedia.org/wiki/XCore_Architecture |
| X-BASIC | The X68000 (Japanese: エックス ろくまんはっせん, Hepburn: Ekkusu Rokuman Hassen) is a home computer created by Sharp Corporation, first released in 1987, sold only in Japan. The first model features a 10 MHz Motorola 68000 CPU (hence the name), 1 MB of RAM, and no hard drive; the last model was released in 1993 with a 25 MHz Motorola 68030 CPU, 4 MB of RAM, and optional 80 MB SCSI hard drive. RAM in these systems is expandable to 12 MB, though most games and applications do not require more than 2 MB. | https://en.wikipedia.org/wiki/X-BASIC |
| Wolfram Language | The Wolfram Language, a general multi-paradigm programming language developed by Wolfram Research, is the programming language of mathematical symbolic computation program Mathematica and the Wolfram Programming Cloud. It emphasizes symbolic computation, functional programming, and rule-based programming and can employ arbitrary structures and data. It includes built-in functions for generating and running Turing machines, creating graphics and audio, analyzing 3D models, matrix manipulations, and solving differential equations. It is extensively documented. The Wolfram language was released for the Raspberry Pi in 2013 with the goal of making it free for all Raspberry Pi users. It was controversially included in the recommended software bundle that the Raspberry Pi Foundation provides for beginners. Plans to port the Wolfram language to the Intel Edison were announced after the board's introduction at CES 2014. There was also a short lived proposal to make Wolfram libraries compatible with the Unity game engine, giving game developers access to the language's high level functions. | https://en.wikipedia.org/wiki/Wolfram_Language |
| WSDL | The Web Services Description Language (WSDL ) is an XML-based interface definition language that is used for describing the functionality offered by a web service. The acronym is also used for any specific WSDL description of a web service (also referred to as a WSDL file), which provides a machine-readable description of how the service can be called, what parameters it expects, and what data structures it returns. Therefore, its purpose is roughly similar to that of a method signature in a programming language. The current version of WSDL is WSDL 2.0. The meaning of the acronym has changed from version 1.1 where the "D" stood for "Definition". | https://en.wikipedia.org/wiki/Web_Services_Description_Language |
| BPEL | The Web Services Business Process Execution Language (WS-BPEL), commonly known as BPEL (Business Process Execution Language), is an OASIS standard executable language for specifying actions within business processes with web services. Processes in BPEL export and import information by using web service interfaces exclusively. | https://en.wikipedia.org/wiki/Business_Process_Execution_Language |
| OWL | The Web Ontology Language (OWL) is a family of knowledge representation languages for authoring ontologies. Ontologies are a formal way to describe taxonomies and classification networks, essentially defining the structure of knowledge for various domains: the nouns representing classes of objects and the verbs representing relations between the objects. Ontologies resemble class hierarchies in object-oriented programming but there are several critical differences. Class hierarchies are meant to represent structures used in source code that evolve fairly slowly (typically monthly revisions) whereas ontologies are meant to represent information on the Internet and are expected to be evolving almost constantly. Similarly, ontologies are typically far more flexible as they are meant to represent information on the Internet coming from all sorts of heterogeneous data sources. Class hierarchies on the other hand are meant to be fairly static and rely on far less diverse and more structured sources of data such as corporate databases. The OWL languages are characterized by formal semantics. They are built upon the World Wide Web Consortium's (W3C) XML standard for objects called the Resource Description Framework (RDF). OWL and RDF have attracted significant academic, medical and commercial interest. In October 2007, a new W3C working group was started to extend OWL with several new features as proposed in the OWL 1.1 member submission. W3C announced the new version of OWL on 27 October 2009. This new version, called OWL 2, soon found its way into semantic editors such as Protégé and semantic reasoners such as Pellet, RacerPro, FaCT++ and HermiT. The OWL family contains many species, serializations, syntaxes and specifications with similar names. OWL and OWL2 are used to refer to the 2004 and 2009 specifications, respectively. Full species names will be used, including specification version (for example, OWL2 EL). When referring more generally, OWL Family will be used. | https://en.wikipedia.org/wiki/Web_Ontology_Language |
| WCPS | The Web Coverage Processing Service (WCPS) defines a language for filtering and processing of multi-dimensional raster coverages, such as sensor, simulation, image, and statistics data. The Web Coverage Processing Service is maintained by the Open Geospatial Consortium (OGC). This raster query language allows clients to obtain original coverage data, or derived information, in a platform-neutral manner over the Web. | https://en.wikipedia.org/wiki/Web_Coverage_Processing_Service |
| VCF | The Variant Call Format (VCF) specifies the format of a text file used in bioinformatics for storing gene sequence variations. The format has been developed with the advent of large-scale genotyping and DNA sequencing projects, such as the 1000 Genomes Project. Existing formats for genetic data such as General feature format (GFF) stored all of the genetic data, much of which is redundant because it will be shared across the genomes. By using the variant call format only the variations need to be stored along with a reference genome. The standard is currently in version 4.3, although the 1000 Genomes Project has developed its own specification for structural variations such as duplications, which are not easily accommodated into the existing schema. A set of tools is also available for editing and manipulating the files. | https://en.wikipedia.org/wiki/Variant_Call_Format |
| UnrealScript | The Unreal Engine is a game engine developed by Epic Games, first showcased in the 1998 first-person shooter game Unreal. Although primarily developed for first-person shooters, it has been successfully used in a variety of other genres, including stealth, fighting games, MMORPGs, and other RPGs. With its code written in C++, the Unreal Engine features a high degree of portability and is a tool used by many game developers today, with it being source-available. The most recent version is Unreal Engine 4, which was released to the public in 2014. | https://en.wikipedia.org/wiki/UnrealScript |
| UML | The Unified Modeling Language (UML) is a general-purpose, developmental, modeling language in the field of software engineering, that is intended to provide a standard way to visualize the design of a system. UML was originally motivated by the desire to standardize the disparate notational systems and approaches to software design developed by Grady Booch, Ivar Jacobson and James Rumbaugh at Rational Software in 1994–1995, with further development led by them through 1996. In 1997 UML was adopted as a standard by the Object Management Group (OMG), and has been managed by this organization ever since. In 2005 UML was also published by the International Organization for Standardization (ISO) as an approved ISO standard. Since then the standard has been periodically revised to cover the latest revision of UML. | https://en.wikipedia.org/wiki/Unified_Modeling_Language |
| NCAR Command Language | The US National Center for Atmospheric Research (NCAR ) is a US federally funded research and development center (FFRDC) managed by the nonprofit University Corporation for Atmospheric Research (UCAR) and funded by the National Science Foundation (NSF). NCAR has multiple facilities, including the I. M. Pei-designed Mesa Laboratory headquarters in Boulder, Colorado. Studies include meteorology, climate science, atmospheric chemistry, solar-terrestrial interactions, environmental and societal impacts. | https://en.wikipedia.org/wiki/NCAR_Command_Language |
| TCP | The Transmission Control Protocol (TCP) is one of the main protocols of the Internet protocol suite. It originated in the initial network implementation in which it complemented the Internet Protocol (IP). Therefore, the entire suite is commonly referred to as TCP/IP. TCP provides reliable, ordered, and error-checked delivery of a stream of octets between applications running on hosts communicating by an IP network. Major Internet applications such as the World Wide Web, email, remote administration, and file transfer rely on TCP. Applications that do not require reliable data stream service may use the User Datagram Protocol (UDP), which provides a connectionless datagram service that emphasizes reduced latency over reliability. | https://en.wikipedia.org/wiki/Transmission_Control_Protocol |
| Tiny C Compiler | The Tiny C Compiler (a.k.a. TCC, tCc, or TinyCC) is an x86, X86-64 and ARM processor C compiler created by Fabrice Bellard. It is designed to work for slow computers with little disk space (e.g. on rescue disks). Windows operating system support was added in version 0.9.23 (17 Jun 2005). TCC is distributed under the GNU Lesser General Public License (LGPL). TCC claims to implement all of ANSI C (C89/C90), much of the C99 ISO standard, and many GNU C extensions including inline assembly. | https://en.wikipedia.org/wiki/Tiny_C_Compiler |
| TAP | The Test Anything Protocol (TAP) is a protocol to allow communication between unit tests and a test harness. It allows individual tests (TAP producers) to communicate test results to the testing harness in a language-agnostic way. Originally developed for unit testing of the Perl interpreter in 1987, producers and parsers are now available for many development platforms. | https://en.wikipedia.org/wiki/Test_Anything_Protocol |
| Template Attribute Language | The Template Attribute Language (TAL) is a templating language used to generate dynamic HTML and XML pages. Its main goal is to simplify the collaboration between programmers and designers. This is achieved by embedding TAL statements inside valid HTML (or XML) tags which can then be worked on using common design tools. TAL was created for Zope but is used in other Python-based projects as well. | https://en.wikipedia.org/wiki/Template_Attribute_Language |
| Tektronix 4050 | The Tektronix 4050 was a series of three computer graphics microcomputers produced by Tektronix in the late 1970s through the early 1980s. The display technology was similar to the Tektronix 4010 terminal, using a storage tube display to avoid the need for video RAM. They were all-in-one designs with the display, keyboard, CPU and DC300 tape drive in a single desktop case. They also included a GPIB parallel bus interface for controlling lab and test equipment as well as connecting to external peripherals. A simple operating system and BASIC interpreter were included in ROM. A key concept of the systems was the use of a storage tube for the display. This allowed the screen to retain images drawn to it, eliminating the need for a framebuffer, computer memory devoted to the display. Most systems of the era had limited resolution due to the expense of the buffer needed to hold higher resolution images, but this was eliminated in the 4050s and allowed the resolution to be as high as the hardware could handle, which was ostensibly 1024 by 1024 but limited by the physical layout of the screen to 1024 by 780. It also allowed the machine to dedicate all of its memory to the programs running on it, as opposed to partitioning off a section for the buffer. The first model, the 4051, was based on 8-bit Motorola 6800 running at a 1 MHz. It normally shipped with 8 KB of RAM and was expandable using 8 KB modules to 32 KB. The remaining 32 KB of address space was reserved for ROM, which could be expanded using two external ROM cartridge of 8 KB each. It included six character sets in ROM and an extended dialect of BASIC that included various vector drawing commands. The 4051 was released in 1975 for the base price of $5,995. Adding the optional RS-232 interface allowed it to emulate a Tektronix 4012 terminal.The second model was the 4052, which in spite of the similar name was a very different system. This had a CPU based on four AMD 2901 4-bit bit-slice processors used together to make a single 16-bit processor. It could also be used in a 6800-compatible mode, allowing it to run software from the 4051, although it did so much faster than the original 4051. Released in 1978, it came with a full 32 KB of RAM for $9,795, and could be expanded to 64 KB for another $1,995. The 4054 was a version of the 4052 built around the 19" screen from the 4014 terminal rather than the 11" screen from the 4012, increasing resolution to 4,096 by 3,072. External storage units were available for the 405x series computers. The 4924 was an external version of the internal DC300 tape drive. The 4907 used single or dual Shugart 851R 8-inch floppy drives with 64 KB floppies and the larger, 2-drawer filing cabinet sized, 4909 storage unit used a CDC 96 megabyte hard drive with the first 16 megabytes in the form of a removable disc-pack. Two sizes of the 4956 graphics tablet offered a slow process for inputing from paper drawings. The 4952 joystick was used for graphics input. Because the direct view storage tubes do not flicker as do conventional CRTs, and because the BASIC programming interface allowed simple, rapid rendering of vector graphic displays, the 405x series were used in many theatrical contexts. In particular, 405x computers can frequently be seen in early Battlestar Galactica sets. The graphic display software was based upon software originally developed in the 1960s by Corning Glass Works for their Type 904 graphics terminal. The display for this system had characteristics to the similar to those of Tektronix storage tube display. It used small pixel regions composed of photosensitive glass, which could be darkened (forming a black line image) by writing, and would display this persistently until the entire display was erased. When Corning left the market this software base was sold to Tektronix. The original demo included an artillery game which was later adapted by high school students at Lindbergh High School in Renton, Washington to the HP 9830, and also adapted by Hewlett Packard for the HP 2647 intelligent graphics terminal demo tape and eventually similar games in Microsoft BASIC for the IBM-PC. Other games for the Tektronix included Weather Wars, with users directing lightning bolts and tornados against opponents in an environment affected by wind. | https://en.wikipedia.org/wiki/Tektronix_4050 |
| T | The T programming language is a dialect of the Scheme programming language developed in the early 1980s by Jonathan A. Rees, Kent M. Pitman, and Norman I. Adams of Yale University as an experiment in language design and implementation. T's purpose is to test the thesis developed by Steele and Sussman in their series of papers about Scheme: that Scheme may be used as the basis for a practical programming language of exceptional expressive power, and that implementations of Scheme could perform better than other Lisp systems, and competitively with implementations of programming languages, such as C and BLISS, which are usually considered to be inherently more efficient than Lisp on conventional machine architectures. In 1987 Stephen Slade published the book "The T Programming Language: A Dialect of LISP". T contains some features that modern Scheme does not have. For example, T is object-oriented, and it has first-class environments, called locales, which can be modified non-locally and used as a module system. T has several extra special forms for lazy evaluation and flow control, as well as an equivalent to Common Lisp's setf. T, like Scheme, supports call-with-current-continuation, but it also has a more limited form called catch. From the T manual, a hypothetical implementation of cons could be: Through this example, we can see that objects in T are intimately related to closures and message-passing. A primitive called join puts two objects together, allowing for something resembling inheritance. | https://en.wikipedia.org/wiki/T_(programming_language) |
| SysML | The Systems Modeling Language (SysML) is a general-purpose modeling language for systems engineering applications. It supports the specification, analysis, design, verification and validation of a broad range of systems and systems-of-systems. SysML was originally developed by an open source specification project, and includes an open source license for distribution and use. SysML is defined as an extension of a subset of the Unified Modeling Language (UML) using UML's profile mechanism. | https://en.wikipedia.org/wiki/Systems_Modeling_Language |
| Systems Biology Markup Language | The Systems Biology Markup Language (SBML) is a representation format, based on XML, for communicating and storing computational models of biological processes. It is a free and open standard with widespread software support and a community of users and developers. SBML can represent many different classes of biological phenomena, including metabolic networks, cell signaling pathways, regulatory networks, infectious diseases, and many others. It has been proposed as a standard for representing computational models in systems biology today. | https://en.wikipedia.org/wiki/SBML |
| S/SL | The Syntax/Semantic Language (S/SL) is an executable high level specification language for recursive descent parsers, semantic analyzers and code generators developed by James Cordy, Ric Holt and David Wortman at the University of Toronto in 1980.S/SL is a small programming language that supports cheap recursion and defines input, output, and error token names (& values), semantic mechanisms (class interfaces whose methods are really escapes to routines in a host programming language but allow good abstraction in the pseudocode) and a pseudocode program that defines the syntax of the input language by the token stream the program accepts. Alternation, control flow and one-symbol look-ahead constructs are part of the language. The S/SL processor compiles this pseudocode into a table (byte-codes) that is interpreted by the S/SL table-walker (interpreter). The pseudocode language processes the input language in LL(1) recursive descent style but extensions allow it to process any LR(k) language relatively easily. S/SL is designed to provide excellent syntax error recovery and repair. It is more powerful and transparent than Yacc but can be slower. S/SL's "semantic mechanisms" extend its capabilities to all phases of compiling, and it has been used to implement all phases of compilation, including scanners, parsers, semantic analyzers, code generators and virtual machine interpreters in multi-pass language processors.S/SL has been used to implement production commercial compilers for languages such as PL/I, Euclid, Turing, Ada, and COBOL, as well as interpreters, command processors, and domain specific languages of many kinds. It is the primary technology used in IBM's ILE/400 COBOL compiler, and the ZMailer mail transfer agent uses S/SL for defining both its mail router processing language and its RFC 822 email address validation. | https://en.wikipedia.org/wiki/S/SL_programming_language |
| SYMBOLIC ASSEMBLY | The Symbolic Assembly Program (SAP) is an assembler program for the IBM 704 computer. It was written by Roy Nutt at United Aircraft Corporation, and was distributed by the SHARE user's group beginning in 1956 as the Share Assembly Program. SAP succeeded an earlier program called NYAP1 (New York Assembly Program 1), which it closely resembled, and became the standard assembler for 704 users. It "set the external form of an assembly language that was to be a model for all its successors and which persists almost unchanged to the present day." | https://en.wikipedia.org/wiki/Symbolic_Assembly_Program |
| Standard for Exchange of Non-clinical Data | The Standard for Exchange of Nonclinical Data (SEND) is an implementation of the CDISC Standard Data Tabulation Model (SDTM) for nonclinical studies, which specifies a way to present nonclinical data in a consistent format. These types of studies are related to animal testing conducted during drug development. Raw data of toxicology animal studies started after December 18, 2016 to support submission of new drugs to the US Food and Drug Administration will be submitted to the agency using SEND. Having a common model to which the industry can conform enables benefits such as the ability for vendors to develop tools, for inter-organizational data exchange that is consistent in format regardless of the parties involved, and so on. A SEND package consists of a few parts, but the main focus is on individual endpoint data. Endpoints typically map to domains (essentially, datasets), with a number of variables (a.k.a., columns or fields). | https://en.wikipedia.org/wiki/Standard_for_Exchange_of_Non-clinical_Data |
| SGML | The Standard Generalized Markup Language (SGML; ISO 8879:1986) is a standard for defining generalized markup languages for documents. ISO 8879 Annex A.1 defines generalized markup: Generalized markup is based on two postulates: Markup should be declarative: it should describe a document's structure and other attributes, rather than specify the processing to be performed on it. Declarative markup is less likely to conflict with unforeseen future processing needs and techniques. Markup should be rigorous so that the techniques available for processing rigorously-defined objects like programs and databases can be used for processing documents as well. HTML was theoretically an example of an SGML-based language until HTML 5, which admits that browsers cannot parse it as SGML (for compatibility reasons) and codifies exactly what they must do instead. DocBook SGML and LinuxDoc are better examples, as they were used almost exclusively with actual SGML tools. | https://en.wikipedia.org/wiki/Standard_Generalized_Markup_Language |
| Squeak | The Squeak programming language is a dialect of Smalltalk. It is object-oriented, class-based, and reflective. It was derived directly from Smalltalk-80 by a group at Apple Computer that included some of the original Smalltalk-80 developers. Its development was continued by the same group at Walt Disney Imagineering, where it was intended for use in internal Disney projects. Later on the group moved on to be supported by HP labs, SAP Labs and most recently Y Combinator. Squeak is cross-platform. Programs produced on one platform run bit-identical on all other platforms, and versions are available for many platforms including the obvious Windows/macOS/linux versions. The Squeak system includes code for generating a new version of the virtual machine (VM) on which it runs. It also includes a VM simulator written in Squeak. For these reasons, it is easily ported. | https://en.wikipedia.org/wiki/Squeak |
| Sort Merge Generator | The Sort Merge Generator was an application developed by Betty Holberton in 1951 for the Univac I and is one of the first examples of using a computer to create a computer program. The input to the application was a specification of files and the kind of sort and merge operations to use, and the output would be machine code for performing the specification. | https://en.wikipedia.org/wiki/Sort_Merge_Generator |
| Shakespeare | The Shakespeare Programming Language (SPL) is an esoteric programming language designed by Jon Åslund and Karl Hasselström. Like the Chef programming language, it is designed to make programs appear to be something other than programs; in this case, Shakespearean plays. A character list in the beginning of the program declares a number of stacks, naturally with names like "Romeo" and "Juliet". These characters enter into dialogue with each other in which they manipulate each other's topmost values, push and pop each other, and do I/O. The characters can also ask each other questions which behave as conditional statements. On the whole, the programming model is very similar to assembly language but much more verbose. | https://en.wikipedia.org/wiki/Shakespeare_Programming_Language |
| Shakespeare | The Shakespeare Programming Language (SPL) is an esoteric programming language designed by Jon Åslund and Karl Hasselström. Like the Chef programming language, it is designed to make programs appear to be something other than programs; in this case, Shakespearean plays. A character list in the beginning of the program declares a number of stacks, naturally with names like "Romeo" and "Juliet". These characters enter into dialogue with each other in which they manipulate each other's topmost values, push and pop each other, and do I/O. The characters can also ask each other questions which behave as conditional statements. On the whole, the programming model is very similar to assembly language but much more verbose. | https://en.wikipedia.org/wiki/Shakespeare_%28programming_language%29 |
| Semantic Web Rule Language | The Semantic Web Rule Language (SWRL) is a proposed language for the Semantic Web that can be used to express rules as well as logic, combining OWL DL or OWL Lite with a subset of the Rule Markup Language (itself a subset of Datalog).The specification was submitted in May 2004 to the W3C by the National Research Council of Canada, Network Inference (since acquired by webMethods), and Stanford University in association with the Joint US/EU ad hoc Agent Markup Language Committee. The specification was based on an earlier proposal for an OWL rules language.SWRL has the full power of OWL DL, but at the price of decidability and practical implementations. However, decidability can be regained by restricting the form of admissible rules, typically by imposing a suitable safety condition.Rules are of the form of an implication between an antecedent (body) and consequent (head). The intended meaning can be read as: whenever the conditions specified in the antecedent hold, then the conditions specified in the consequent must also hold. | https://en.wikipedia.org/wiki/Semantic_Web_Rule_Language |
| Secure Operations Language | The Secure Operations Language (SOL) was developed jointly by the United States Naval Research Laboratory and Utah State University in the United States. SOL is a domain-specific synchronous programming language for developing distributed applications and is based on software engineering principles developed in the Software Cost Reduction project at the Naval Research Laboratory in the late 1970s and early 1980s. SOL is intended to be a domain-specific language for developing service-based systems. Concurrently, a domain-specific extension of Java (SOLj) is being developed (FTDCS 2007) Application domains include sensor networks, defense and space systems, healthcare delivery, power control, etc. The investigators of the project are Dr. Ramesh Bharadwaj from the Naval Research Laboratory and Dr. Supratik Mukhopadhyay from Utah State University. | https://en.wikipedia.org/wiki/Secure_Operations_Language |
| SAS | The SAS language is a computer programming language used for statistical analysis, created by Anthony James Barr at North Carolina State University. It can read in data from common spreadsheets and databases and output the results of statistical analyses in tables, graphs, and as RTF, HTML and PDF documents. The SAS language runs under compilers that can be used on Microsoft Windows, Linux, and various other UNIX and mainframe computers. The SAS System and World Programming System (WPS) are SAS language compilers. | https://en.wikipedia.org/wiki/SAS_language |
| Sam Coupé | The SAM Coupé (pronounced /sæm ku:peɪ/ from its original British English branding) is an 8-bit British home computer that was first released in late 1989. It is commonly considered a clone of the Sinclair ZX Spectrum computer, since it features a compatible screen mode and emulated compatibility, and it was marketed as a logical upgrade from the Spectrum. It was originally manufactured by Miles Gordon Technology (MGT), based in Swansea in the United Kingdom. | https://en.wikipedia.org/wiki/SAM_Coup%C3%A9 |
| Simple Actor Language System and Architecture | The SALSA programming language (Simple Actor Language System and Architecture) is an actor-oriented programming language that uses concurrency primitives beyond asynchronous message passing, including token-passing, join, and first-class continuations. It also supports distributed computing over the Internet with universal naming, remote communication, and migration linguistic abstractions and associated middleware. For portability, it produces Java code. | https://en.wikipedia.org/wiki/SALSA_(programming_language) |
| RDF | The Resource Description Framework (RDF) is a family of World Wide Web Consortium (W3C) specifications originally designed as a metadata data model. It has come to be used as a general method for conceptual description or modeling of information that is implemented in web resources, using a variety of syntax notations and data serialization formats. It is also used in knowledge management applications. RDF was adopted as a W3C recommendation in 1999. The RDF 1.0 specification was published in 2004, the RDF 1.1 specification in 2014. | https://en.wikipedia.org/wiki/Resource_Description_Framework |
| Ren'Py | The Ren'Py Visual Novel Engine is a free software engine which facilitates the creation of visual novels, a form of computer-mediated storytelling. Ren'Py is a portmanteau of ren'ai (恋愛), the Japanese word for 'romantic love', a common element of games made using Ren'Py; and Python, the programming language that Ren'Py runs on. Ren'Py has proved attractive to English-language hobbyists; over 1000 games use the Ren'Py engine, nearly all in English. | https://en.wikipedia.org/wiki/Ren'Py |
| Real-time Transport Protocol | The Real-time Transport Protocol (RTP) is a network protocol for delivering audio and video over IP networks. RTP is used in communication and entertainment systems that involve streaming media, such as telephony, video teleconference applications including WebRTC, television services and web-based push-to-talk features. RTP typically runs over User Datagram Protocol (UDP). RTP is used in conjunction with the RTP Control Protocol (RTCP). While RTP carries the media streams (e.g., audio and video), RTCP is used to monitor transmission statistics and quality of service (QoS) and aids synchronization of multiple streams. RTP is one of the technical foundations of Voice over IP and in this context is often used in conjunction with a signaling protocol such as the Session Initiation Protocol (SIP) which establishes connections across the network. RTP was developed by the Audio-Video Transport Working Group of the Internet Engineering Task Force (IETF) and first published in 1996 as RFC 1889, superseded by RFC 3550 in 2003. | https://en.wikipedia.org/wiki/Real-time_Transport_Protocol |
| Ravenscar profile | The Ravenscar profile is a subset of the Ada tasking features designed for safety-critical hard real-time computing. It was defined by a separate technical report in Ada 95; it is now part of the Ada 2012 Standard. It has been named after the English village of Ravenscar, the location of the 8th International Real-Time Ada Workshop (IRTAW 8). | https://en.wikipedia.org/wiki/Ravenscar_profile |
| TRS-80 Color Computer | The RadioShack TRS-80 Color Computer (later marketed as the Tandy Color Computer and sometimes nicknamed the CoCo) is a line of home computers based on the Motorola 6809 processor. The Tandy Color Computer line started in 1980 with what is now called the CoCo 1 and ended in 1991 with the more powerful CoCo 3. All three CoCo models maintained a high level of software and hardware compatibility, with few programs written for the older model not running on the newer ones. Despite bearing the TRS-80 name, the Color Computer is a radical departure from the earlier TRS-80; in particular it has a Motorola 6809E processor, rather than the TRS-80's Zilog Z80. The machines in the Color Computer line are not compatible with software made for the earlier TRS-80. | https://en.wikipedia.org/wiki/TRS-80_Color_Computer |
| R2ML | The REWERSE Rule Markup Language (R2ML) is developed by the REWERSE Working Group I1 for the purpose of rules interchange between different systems and tools. | https://en.wikipedia.org/wiki/R2ML |
| Python for S60 | The Python for S60 also called PyS60 (Unix name), was Nokia’s port of the general Python programming language to its S60 software platform, originally based on Python 2.2.2 from 2002. The latest final version, PyS60-2.0.0, released on 11 February 2010 updated the python core to version 2.5.4. | https://en.wikipedia.org/wiki/Python_for_S60 |
| PVS | The Prototype Verification System (PVS) is a specification language integrated with support tools and an automated theorem prover, developed at the Computer Science Laboratory of SRI International in Menlo Park, California. PVS is based on a kernel consisting of an extension of Church's theory of types with dependent types, and is fundamentally a classical typed higher-order logic. The base types include uninterpreted types that may be introduced by the user, and built-in types such as the booleans, integers, reals, and the ordinals. Type-constructors include functions, sets, tuples, records, enumerations, and abstract data types. Predicate subtypes and dependent types can be used to introduce constraints; these constrained types may incur proof obligations (called type-correctness conditions or TCCs) during typechecking. PVS specifications are organized into parameterized theories. The system is implemented in Common Lisp, and is released under the GNU General Public License (GPL). | https://en.wikipedia.org/wiki/Prototype_Verification_System |
| Preferred Executable Format | The Preferred Executable Format is a file format that specifies the format of executable files and other object code. PEF executables are also called Code Fragment Manager files (CFM). PEF was developed by Apple Computer for use in its classic Mac OS operating system. It was optimised for RISC processors. In macOS, the Mach-O file format is the native executable format. However, PEF is still supported on PowerPC-based Macintoshes running Mac OS X and is used by some Carbon applications ported from earlier versions for classic Mac OS, so that the same binary can be run on classic Mac OS and Mac OS X. BeOS on PowerPC systems also uses PEF, although x86 systems do not. | https://en.wikipedia.org/wiki/Preferred_Executable_Format |
| The Portable Document Format (PDF) is a file format used to present documents in a manner independent of application software, hardware, and operating systems. Each PDF file encapsulates a complete description of a fixed-layout flat document, including the text, fonts, graphics, and other information needed to display it. | https://en.wikipedia.org/wiki/Portable_Document_Format | |
| Polymorphic Programming Language | The Polymorphic Programming Language (PPL) was developed in 1969 at Harvard University by Thomas A. Standish. It is an interactive, extensible language with a base language similar to the language APL.The assignment operator <- (or ←) has influenced the language S. | https://en.wikipedia.org/wiki/Polymorphic_Programming_Language |
| Pick operating system | The Pick operating system (often called just "the Pick system" or simply "Pick") is a demand-paged, multiuser, virtual memory, time-sharing computer operating system based around a unique MultiValue database. Pick is used primarily for business data processing. It is named after one of its developers, Dick Pick. The term "Pick system" has also come to be used as the general name of all operating environments which employ this multivalued database and have some implementation of Pick/BASIC and ENGLISH/Access queries. Although Pick started on a variety of minicomputers, the system and its various implementations eventually spread to a large assortment of microcomputers, personal computers and mainframe computers. | https://en.wikipedia.org/wiki/Pick_operating_system |
| PIR | The Parrot intermediate representation (PIR), previously called Intermediate code (IMC), is one of the two assembly languages for the Parrot virtual machine. The other is Parrot assembly language or PASM. Compared to PASM, PIR exists at a slightly higher abstraction layer, and provides temporary registers and named registers, simplifying code generation. While Parrot is still evolving, it is currently being used in many different capacities, and has undergone several releases. | https://en.wikipedia.org/wiki/Parrot_intermediate_representation |
| Parrot Assembly | The Parrot assembly language (PASM) is the basic assembly language used by the Parrot virtual machine. PASM is the lowest level assembly language in the Parrot stack. The Parrot intermediate representation (PIR) is PASM extended to simplify development of compilers. The hello world program in PASM is simply: print "Hello world!\n" end Although it appears similar to source code in some high-level programming languages, more complex PASM programs will resemble other assembly languages. The main exceptions to this low level programming in PASM are string handling and, as shown above, input and output. Additionally, PASM has automatic garbage collection from the virtual machine, and it does not allow pointer arithmetic. Parrot assembly language has more instructions than hardware assembly languages, even CISC processors. This is because the marginal cost of creating a new instruction in Parrot is low compared to the marginal cost of doing so in hardware, and the creators of Parrot had no particular goal of minimalism. | https://en.wikipedia.org/wiki/Parrot_assembly_language |
| Parallax Propeller | The Parallax P8X32A Propeller is a multi-core processor parallel computer architecture microcontroller chip with eight 32-bit reduced instruction set computer (RISC) central processing unit (CPU) cores. Introduced in 2006, it is designed and sold by Parallax, Inc. The Propeller microcontroller, Propeller assembly language, and Spin interpreter were designed by one person, Parallax's cofounder and president, Chip Gracey. The Spin programming language and Propeller Tool integrated development environment (IDE) were designed by Chip Gracey and Parallax's software engineer Jeff Martin. On August 6, 2014, Parallax Inc., released all of the Propeller 1 P8X32A hardware and tools as open-source hardware and software under the GNU General Public License (GPL) 3.0. This included the Verilog code, top-level hardware description language (HDL) files, Spin interpreter, PropellerIDE and SimpleIDE programming tools, and compilers. | https://en.wikipedia.org/wiki/Parallax_Propeller |
| PL/P | The PL/P programming language (an acronym of Programming Language for Prime (computers)) is a mid-level programming language developed by Prime Computer to serve as their second primary system programming language after Fortran IV. PL/P was a subset of PL/I. Additions to the PRIMOS operating system for Prime 50 Series computers were written mostly in PL/P in later years. Certain PRIMOS modules written in Fortran IV during PRIMOS's early years were rewritten in PL/P. PL/P was the most widespread compiled programming language used for commercial PRIMOS applications, outpacing the use of the Prime C compiler, the CPL (PRIMOS) scripting language, and the Fortran IV compiler in commercial applications. | https://en.wikipedia.org/wiki/PL/P |
| PL/M | The PL/M programming language (an acronym of Programming Language for Microcomputers) is a high-level language conceived and developed by Gary Kildall in 1973 for Hank Smith at Intel for its microprocessors. The language incorporated ideas from PL/I, ALGOL and XPL, and had an integrated macro processor. Unlike other contemporary languages such as Pascal, C or BASIC, PL/M had no standard input or output routines. It included features targeted at the low-level hardware specific to the target microprocessors, and as such, it could support direct access to any location in memory, I/O ports and the processor interrupt flags in a very efficient manner. PL/M was the first higher level programming language for microprocessor-based computers and was the original implementation language for the CP/M operating system. Many Intel and Zilog Z80 based embedded systems were programmed in PL/M during the 1970s and 1980s. For instance, the firmware of the Service Processor component of CISC AS/400 was written in PL/M. The original PL/M compiler targeted the Intel 8008. An updated version generated code for the 8080 processor, which would also run on the newer Intel 8085 as well as on the Zilog Z80 family (as it is backward-compatible with the 8080). Later followed compilers for the Intel 8048 and Intel 8051-microcontroller family as well as for the 8086 (8088), 80186 (80188) and subsequent 8086-based processors, including the advanced 80286 and the 32-bit 80386. There were also PL/M compilers developed for later microcontrollers, such as the Intel 8061 and 8096 / MCS-96 architecture family. While some PL/M compilers were "native", meaning that they ran on systems using that same microprocessor, e.g. for the Intel ISIS operating system, there were also "cross compilers", for instance PLMX, which ran on other operating environments such as CP/M, Microsoft's DOS, and Digital Equipment Corporation's VAX/VMS. PL/M is no longer supported by Intel, but aftermarket tools like PL/M-to-C translators exist (for examples, see External links, below). | https://en.wikipedia.org/wiki/PL/M |
| PDP-11 | The PDP-11 is a series of 16-bit minicomputers sold by Digital Equipment Corporation (DEC) from 1970 into the 1990s, one of a succession of products in the PDP series. In total, around 600,000 PDP-11s of all models were sold, making it one of DEC's most successful product lines. The PDP-11 is considered by some experts to be the most popular minicomputer ever. The PDP-11 included a number of innovative features in its instruction set and additional general-purpose registers that made it much easier to program than earlier models in the series. Additionally, the innovative Unibus system allowed external devices to be easily interfaced to the system using direct memory access, opening the system to a wide variety of peripherals. The PDP-11 replaced the PDP-8 in many real-time applications, although both product lines lived in parallel for more than 10 years. The ease of programming of the PDP-11 made it very popular for general purpose computing uses as well. The design of the PDP-11 inspired the design of late-1970s microprocessors including the Intel x86 and the Motorola 68000. Design features of PDP-11 operating systems, as well as other operating systems from Digital Equipment, influenced the design of other operating systems such as CP/M and hence also MS-DOS. The first officially named version of Unix ran on the PDP-11/20 in 1970. It is commonly stated that the C programming language took advantage of several low-level PDP-11–dependent programming features, albeit not originally by design.An effort to expand the PDP-11 from 16 to 32-bit addressing led to the VAX-11 design, which took part of its name from the PDP-11. | https://en.wikipedia.org/wiki/PDP-11 |
| ODRL | The Open Digital Rights Language (ODRL) is a policy expression language that provides a flexible and interoperable information model, vocabulary, and encoding mechanisms for representing statements about the usage of content and services. An example of ODRL policy follows, which can be intepreted as "John can play mysong.mp3". | https://en.wikipedia.org/wiki/ODRL |
| Object Rexx | The Object REXX programming language is an object-oriented scripting language initially produced by IBM for OS/2. It is a follow-on to and a significant extension of the "Classic Rexx" language originally created for the CMS component of VM/SP and later ported to MVS, OS/2 and PC DOS. OS/2 version of IBM Object REXX is deeply integrated with SOM. On October 12, 2004, IBM released Object REXX as open source software, giving rise to Open Object Rexx (ooREXX), now available for various operating systems: Linux, Solaris, Windows. This implementation includes a WSH Scripting Engine for Rexx. The released sources however didn't include significant piece of the SOM support. Object REXX supports multiple inheritance via the use of mixin classes. | https://en.wikipedia.org/wiki/Object_REXX |
| OEM | The Object Exchange Model (OEM) is a model for exchanging semi-structured data between object-oriented databases. It serves as the basic data model in numerous projects of the Stanford University Database Group, including Tsimmis, Lore, and C3. Slight variations of OEM have evolved across different Stanford projects. In Lore, labels are actually on parent-child "links" rather than objects. For example, if an OEM object has multiple parents, different parent objects may use different labels to identify that object. An atomic value encoding a person's name might be included in one complex object using the label "Author" and in another complex object using the label "Editor." In C3, additional attributes are required for each object to annotate the changes to the object that have occurred over time. | https://en.wikipedia.org/wiki/Object_Exchange_Model |
| OCL | The Object Constraint Language (OCL) is a declarative language describing rules applying to Unified Modeling Language (UML) models developed at IBM and is now part of the UML standard. Initially, OCL was merely a formal specification language extension for UML. OCL may now be used with any Meta-Object Facility (MOF) Object Management Group (OMG) meta-model, including UML. The Object Constraint Language is a precise text language that provides constraint and object query expressions on any MOF model or meta-model that cannot otherwise be expressed by diagrammatic notation. OCL is a key component of the new OMG standard recommendation for transforming models, the Queries/Views/Transformations (QVT) specification. | https://en.wikipedia.org/wiki/Object_Constraint_Language |
| Network Time Protocol | The Network Time Protocol (NTP) is a networking protocol for clock synchronization between computer systems over packet-switched, variable-latency data networks. In operation since before 1985, NTP is one of the oldest Internet protocols in current use. NTP was designed by David L. Mills of the University of Delaware. NTP is intended to synchronize all participating computers to within a few milliseconds of Coordinated Universal Time (UTC). It uses the intersection algorithm, a modified version of Marzullo's algorithm, to select accurate time servers and is designed to mitigate the effects of variable network latency. NTP can usually maintain time to within tens of milliseconds over the public Internet, and can achieve better than one millisecond accuracy in local area networks under ideal conditions. Asymmetric routes and network congestion can cause errors of 100 ms or more.The protocol is usually described in terms of a client-server model, but can as easily be used in peer-to-peer relationships where both peers consider the other to be a potential time source. Implementations send and receive timestamps using the User Datagram Protocol (UDP) on port number 123. They can also use broadcasting or multicasting, where clients passively listen to time updates after an initial round-trip calibrating exchange. NTP supplies a warning of any impending leap second adjustment, but no information about local time zones or daylight saving time is transmitted.The current protocol is version 4 (NTPv4), which is a proposed standard as documented in RFC 5905. It is backward compatible with version 3, specified in RFC 1305. | https://en.wikipedia.org/wiki/Network_Time_Protocol |
| Netwide Assembler | The Netwide Assembler (NASM) is an assembler and disassembler for the Intel x86 architecture. It can be used to write 16-bit, 32-bit (IA-32) and 64-bit (x86-64) programs. NASM is considered to be one of the most popular assemblers for Linux. NASM was originally written by Simon Tatham with assistance from Julian Hall. As of 2016, it is maintained by a small team led by H. Peter Anvin. It is open-source software released under the terms of a simplified (2-clause) BSD license. | https://en.wikipedia.org/wiki/Netwide_Assembler |
| NELIAC | The Navy Electronics Laboratory International ALGOL Compiler or NELIAC is a dialect and compiler implementation of the ALGOL 58 programming language developed by the Naval Electronics Laboratory in 1958. It was designed for numeric and logical computations and was the first language to provide a bootstrap implementation. | https://en.wikipedia.org/wiki/NELIAC |
| Natural Language Toolkit | The Natural Language Toolkit, or more commonly NLTK, is a suite of libraries and programs for symbolic and statistical natural language processing (NLP) for English written in the Python programming language. It was developed by Steven Bird and Edward Loper in the Department of Computer and Information Science at the University of Pennsylvania. NLTK includes graphical demonstrations and sample data. It is accompanied by a book that explains the underlying concepts behind the language processing tasks supported by the toolkit, plus a cookbook. NLTK is intended to support research and teaching in NLP or closely related areas, including empirical linguistics, cognitive science, artificial intelligence, information retrieval, and machine learning. NLTK has been used successfully as a teaching tool, as an individual study tool, and as a platform for prototyping and building research systems. There are 32 universities in the US and 25 countries using NLTK in their courses. NLTK supports classification, tokenization, stemming, tagging, parsing, and semantic reasoning functionalities.. | https://en.wikipedia.org/wiki/Natural_Language_Toolkit |
| Nexus file | The NEXUS file format (usually .nex or .nxs) is widely used in bioinformatics. Several popular phylogenetic programs such as PAUP*, MrBayes, Mesquite,, MacClade and SplitsTree use this format. | https://en.wikipedia.org/wiki/Nexus_file |
| NATO phonetic alphabet | The NATO phonetic alphabet, officially denoted as the International Radiotelephony Spelling Alphabet, and also commonly known as the ICAO phonetic alphabet, and in a variation also known officially as the ITU phonetic alphabet and figure code, is the most widely used radiotelephone spelling alphabet. Although often called "phonetic alphabets", spelling alphabets are unrelated to phonetic transcription systems such as the International Phonetic Alphabet. Instead, the International Civil Aviation Organization (ICAO) alphabet assigned codewords acrophonically to the letters of the English alphabet, so that critical combinations of letters and numbers are most likely to be pronounced and understood by those who exchange voice messages by radio or telephone, regardless of language differences or the quality of the communication channel.The 26 code words in the NATO phonetic alphabet are assigned to the 26 letters of the English alphabet in alphabetical order as follows: Alfa, Bravo, Charlie, Delta, Echo, Foxtrot, Golf, Hotel, India, Juliett, Kilo, Lima, Mike, November, Oscar, Papa, Quebec, Romeo, Sierra, Tango, Uniform, Victor, Whiskey, X-ray, Yankee, Zulu.Strict adherence to the prescribed spelling words is required in order to avoid the problems of confusion that the spelling alphabet is designed to overcome. As noted in a 1955 NATO memo, It is known that [the ICAO spelling alphabet] has been prepared only after the most exhaustive tests on a scientific basis by several nations. One of the firmest conclusions reached was that it was not practical to make an isolated change to clear confusion between one pair of letters. To change one word involves reconsideration of the whole alphabet to ensure that the change proposed to clear one confusion does not itself introduce others. The same memo notes a potential confusion between ZERO and SIERRA is overcome when following the procedures in ACP 125, which specify the use of the procedure word FIGURES in many instances in which digits need to be read. | https://en.wikipedia.org/wiki/NATO_phonetic_alphabet |
| Mouse | The Mouse programming language is a small computer programming language developed by Dr. Peter Grogono in the late 1970s and early 1980s. It was developed as an extension of an earlier language called MUSYS, which was used to control digital and analog devices in an electronic music studio. Mouse was originally intended as a small, efficient language for microcomputers with limited memory. It is an interpreted, stack-based language and uses Reverse Polish notation. To make an interpreter as easy as possible to implement, Mouse is designed so that a program is processed as a stream of characters, interpreted one character at a time. The elements of the Mouse language consist of a set of (mostly) one-character symbols, each of which performs a specific function (see table below). Since variable names are limited to one character, there are only 26 possible variables in Mouse (named A-Z). Integers and characters are the only available data types. Despite these limits, Mouse includes a number of relatively advanced features, including: Conditional branching Loops Pointers Macros (subroutines (which may be recursive)) Arrays Code tracingThe design of the Mouse language makes it ideal for teaching the design of a simple interpreter. Much of the book describing Mouse is devoted to describing the implementation of two interpreters, one in Z80 assembly language, the other in Pascal. | https://en.wikipedia.org/wiki/Mouse_(programming_language) |
| Modula | The Modula programming language is a descendant of the Pascal programming language. It was developed in Switzerland in the 1970s by Niklaus Wirth, the same person who designed Pascal. The main innovation of Modula over Pascal is a module system, used for grouping sets of related declarations into program units; hence the name Modula. The language is defined in a report by Wirth called Modula. A language for modular multiprogramming published 1976. Modula was first implemented by Niklaus Wirth himself on a PDP-11. Very soon other implementations followed, most important the University of York Modula compiler and a compiler developed at Philips Laboratories named PL Modula, which generated code for the LSI-11 microprocessor. The development of Modula was discontinued soon after its publication. Wirth then concentrated his efforts on Modula's successor, Modula-2. | https://en.wikipedia.org/wiki/Modula |
| MiniD | The MiniD (has been renamed Croc) programming language is a small, lightweight, extension language in the vein of Lua or Squirrel, but designed to be used mainly with the D programming language. It supports both object-oriented and imperative programming paradigms, as well as some simple functional aspects. Distributed under the licence of zlib/libpng, MiniD is free software. | https://web.archive.org/web/20190311032913/https://en.wikipedia.org/wiki/MiniD |
| Croc | The MiniD (has been renamed Croc) programming language is a small, lightweight, extension language in the vein of Lua or Squirrel, but designed to be used mainly with the D programming language. It supports both object-oriented and imperative programming paradigms, as well as some simple functional aspects. Distributed under the licence of zlib/libpng, MiniD is free software. | https://web.archive.org/web/20190311032913/https://en.wikipedia.org/wiki/MiniD |
| Microsoft Macro Assembler | The Microsoft Macro Assembler (MASM) is an x86 assembler that uses the Intel syntax for MS-DOS and Microsoft Windows. Beginning with MASM 8.0 there are two versions of the assembler - one for 16-bit and 32-bit assembly sources, and another (ML64) for 64-bit sources only. MASM is maintained by Microsoft, but since version 6.12 has not been sold as a separate product, it is instead supplied with various Microsoft SDKs and C compilers. Recent versions of MASM are included with Microsoft Visual Studio. | https://en.wikipedia.org/wiki/Microsoft_Macro_Assembler |
| Maya Embedded Language | The Maya Embedded Language (MEL) is a scripting language used to simplify tasks in Autodesk's 3D Graphics Software Maya. Most tasks that can be achieved through Maya's GUI can be achieved with MEL, as well as certain tasks that are not available from the GUI. MEL offers a method of speeding up complicated or repetitive tasks, as well as allowing users to redistribute a specific set of commands to others that may find it useful. | https://en.wikipedia.org/wiki/Maya_Embedded_Language |
| Matrix Market Coordinate Format | The Matrix Market exchange formats are a set of human readable, ASCII-based file formats designed to facilitate the exchange of matrix data. The file formats were designed and adopted for the Matrix Market, a NIST repository for test data for use in comparative studies of algorithms for numerical linear algebra. | https://en.wikipedia.org/wiki/Matrix_Market_exchange_formats |
| TI MSP430 | The MSP430 is a mixed-signal microcontroller family from Texas Instruments. Built around a 16-bit CPU, the MSP430 is designed for low cost and, specifically, low power consumption embedded applications. | https://en.wikipedia.org/wiki/TI_MSP430 |
| MOO | The MOO programming language is a relatively simple programming language used to support the MOO Server. It is dynamically typed and uses a prototype-based object-oriented system, with syntax roughly derived from the Algol school of programming languages. | https://en.wikipedia.org/wiki/MOO_(programming_language) |
| MD5 | The MD5 message-digest algorithm is a widely used hash function producing a 128-bit hash value. Although MD5 was initially designed to be used as a cryptographic hash function, it has been found to suffer from extensive vulnerabilities. It can still be used as a checksum to verify data integrity, but only against unintentional corruption. It remains suitable for other non-cryptographic purposes, for example for determining the partition for a particular key in a partitioned database.MD5 was designed by Ronald Rivest in 1991 to replace an earlier hash function MD4, and was specified in 1992 as RFC 1321. One basic requirement of any cryptographic hash function is that it should be computationally infeasible to find two distinct messages that hash to the same value. MD5 fails this requirement catastrophically; such collisions can be found in seconds on an ordinary home computer. The weaknesses of MD5 have been exploited in the field, most infamously by the Flame malware in 2012. The CMU Software Engineering Institute considers MD5 essentially "cryptographically broken and unsuitable for further use".As of 2019, MD5 continues to be widely used, in spite of its well-documented weaknesses and deprecation by security experts. | https://en.wikipedia.org/wiki/MD5 |
| Lightweight Directory Access Protocol | The Lightweight Directory Access Protocol (LDAP ) is an open, vendor-neutral, industry standard application protocol for accessing and maintaining distributed directory information services over an Internet Protocol (IP) network. Directory services play an important role in developing intranet and Internet applications by allowing the sharing of information about users, systems, networks, services, and applications throughout the network. As examples, directory services may provide any organized set of records, often with a hierarchical structure, such as a corporate email directory. Similarly, a telephone directory is a list of subscribers with an address and a phone number. LDAP is specified in a series of Internet Engineering Task Force (IETF) Standard Track publications called Request for Comments (RFCs), using the description language ASN.1. The latest specification is Version 3, published as RFC 4511 (a road map to the technical specifications is provided by RFC4510). A common use of LDAP is to provide a central place to store usernames and passwords. This allows many different applications and services to connect to the LDAP server to validate users.LDAP is based on a simpler subset of the standards contained within the X.500 standard. Because of this relationship, LDAP is sometimes called X.500-lite. | https://en.wikipedia.org/wiki/Lightweight_Directory_Access_Protocol |
| Legal Knowledge Interchange Format | The Legal Knowledge Interchange Format (LKIF) was developed in the European ESTRELLA project and was designed with the goal of becoming a standard for representing and interchanging policy, legislation and cases, including their justificatory arguments, in the legal domain. LKIF builds on and uses the Web Ontology Language (OWL) for representing concepts and includes a reusable basic ontology of legal concepts. The core of LKIF consists of a combination of OWL-DL and SWRL.LKIF was designed with two main roles in mind: the translation of legal knowledge bases written in different representation formats and formalisms and to be a knowledge representation formalism which could be part of larger architectures for developing legal knowledge systems. | https://en.wikipedia.org/wiki/Legal_Knowledge_Interchange_Format |
| Laning and Zierler system | The Laning and Zierler system (sometimes called "George" by its users) was one of the first operating algebraic compilers, that is, a system capable of accepting mathematical formulae in algebraic notation and producing equivalent machine code (the term compiler had not yet been invented and the system was referred to as "an interpretive program"). It was implemented in 1952 for the MIT WHIRLWIND by J. Halcombe Laning and Neal Zierler. It is preceded by the UNIVAC A-2, IBM Speedcoding and a number of systems that were proposed but never implemented. | https://en.wikipedia.org/wiki/Laning_and_Zierler_system |
| LLVM IR | The LLVM compiler infrastructure project is a "collection of modular and reusable compiler and toolchain technologies" used to develop compiler front ends and back ends. LLVM is written in C++ and is designed for compile-time, link-time, run-time, and "idle-time" optimization of programs written in arbitrary programming languages. Originally implemented for C and C++, the language-agnostic design of LLVM has since spawned a wide variety of front ends: languages with compilers that use LLVM include ActionScript, Ada, C#, Common Lisp, Crystal, D, Delphi, Fortran, OpenGL Shading Language, Halide, Haskell, Java bytecode, Julia, Lua, Objective-C, Pony, Python, R, Ruby, Rust, CUDA, Scala, Swift, and Xojo. The LLVM project started in 2000 at the University of Illinois at Urbana–Champaign, under the direction of Vikram Adve and Chris Lattner. LLVM was originally developed as a research infrastructure to investigate dynamic compilation techniques for static and dynamic programming languages. LLVM was released under the University of Illinois/NCSA Open Source License, a permissive free software licence. In 2005, Apple Inc. hired Lattner and formed a team to work on the LLVM system for various uses within Apple's development systems. LLVM is an integral part of Apple's latest development tools for macOS and iOS. Since 2013, Sony has been using LLVM's primary front end Clang compiler in the software development kit (SDK) of its PS4 console. The name LLVM was originally an initialism for Low Level Virtual Machine. This initialism has offically been removed to avoid confusion, as the LLVM has evolved into an umbrella project that has little relationship to what most current developers think of as virtual machines. Now, LLVM is a brand that applies to the LLVM umbrella project, the LLVM intermediate representation (IR), the LLVM debugger, the LLVM C++ Standard Library (with full support of C++11 and C++14), etc. LLVM is administered by the LLVM Foundation. Its president is compiler engineer Tanya Lattner. The Association for Computing Machinery presented Adve, Lattner, and Evan Cheng with the 2012 ACM Software System Award for LLVM. | https://en.wikipedia.org/wiki/LLVM |
| ACT-III | The LGP-30, standing for Librascope General Purpose and then Librascope General Precision, was an early off-the-shelf computer. It was manufactured by the Librascope company of Glendale, California (a division of General Precision Inc.), and sold and serviced by the Royal Precision Electronic Computer Company, a joint venture with the Royal McBee division of the Royal Typewriter Company. The LGP-30 was first manufactured in 1956 with a retail price of $47,000—equivalent to about $423,000 in 2017.The LGP-30 was commonly referred to as a desk computer. It was 26 inches (660 mm) deep, 33 inches (840 mm) high, and 44 inches (1120 mm) long, exclusive of the typewriter shelf. The computer weighed approximately 800 pounds (360 kg) and was mounted on sturdy casters which facilitated movement of the computer. | https://en.wikipedia.org/wiki/LGP-30 |
| Knowledge Query and Manipulation Language | The Knowledge Query and Manipulation Language, or KQML, is a language and protocol for communication among software agents and knowledge-based systems. It was developed in the early 1990s part of the DARPA knowledge Sharing Effort, which was aimed at developing techniques for building large-scale knowledge bases which are shareable and reusable. While originally conceived of as an interface to knowledge based systems, it was soon repurposed as an Agent communication language.Work on KQML was led by Tim Finin of the University of Maryland, Baltimore County and Jay Weber of EITech and involved contributions from many researchers. The KQML message format and protocol can be used to interact with an intelligent system, either by an application program, or by another intelligent system. KQML's "performatives" are operations that agents perform on each other's knowledge and goal stores. Higher-level interactions such as contract nets and negotiation are built using these. KQML's "communication facilitators" coordinate the interactions of other agents to support knowledge sharing. Experimental prototype systems support concurrent engineering, intelligent design, intelligent planning, and scheduling. KQML is superseded by FIPA-ACL. | https://en.wikipedia.org/wiki/Knowledge_Query_and_Manipulation_Language |
| Klerer-May System | The Klerer–May System is a programming language developed in the mid-1960s, oriented to numerical scientific programming, whose most notable feature is its two-dimensional syntax based on traditional mathematical notation. For input and output, the Klerer–May system used a Friden Flexowriter modified to allow half-line motions for subscripts and superscripts. The character set included digits, upper-case letters, subsets of 14 lower-case Latin letters and 18 Greek letters, arithmetic operators (+ − × / |) and punctuation (. , ( )), and eight special line-drawing characters (resembling ╲ ╱ ⎜ _ ⎨ ⎬ ˘ ⁔) used to construct multi-line brackets and symbols for summation, products, roots, and for multi-line division or fractions. The system was intended to be forgiving of input mistakes, and easy to learn; its reference manual was only two pages.The system was developed by Melvin Klerer and Jack May at Columbia University's Hudson Laboratories in Dobbs Ferry, New York, for the Office of Naval Research, and ran on GE-200 series computers. | https://en.wikipedia.org/wiki/Klerer–May_System |
| Kaleidoscope | The Kaleidoscope programming language is a constraint programming language embedding constraints into an imperative object-oriented language. It adds keywords always, once, and assert..during (formerly while..assert) to make statements about relational invariants. Objects have constraint constructors, which are not methods, to enforce the meanings of user-defined datatypes. There are three versions of Kaleidoscope which show an evolution from declarative to an increasingly imperative style. Differences between them are as follows. | https://en.wikipedia.org/wiki/Kaleidoscope_(programming_language) |
| KUKA Robot Language | The KUKA Robot Language, also known as KRL, is a proprietary programming language similar to Pascal and used to control KUKA robots. | https://en.wikipedia.org/wiki/KUKA_Robot_Language |
| Joy | The Joy programming language in computer science is a purely functional programming language that was produced by Manfred von Thun of La Trobe University in Melbourne, Australia. Joy is based on composition of functions rather than lambda calculus. It has turned out to have many similarities to Forth, due not to design but to a sort of parallel evolution and convergence. It was also inspired by the function-level programming style of Backus's FP. | https://en.wikipedia.org/wiki/Joy_(programming_language) |
| Jet Propulsion Laboratory Display Information System | The Jet Propulsion Laboratory Display Information System (or JPLDIS) is a file management program written in FORTRAN. JPLDIS is important because it was the inspiration and precursor to dBASE, arguably one of the most influential DBMS programs for early microcomputers. | https://en.wikipedia.org/wiki/Jet_Propulsion_Laboratory_Display_Information_System |
| J | The J programming language, developed in the early 1990s by Kenneth E. Iverson and Roger Hui, is a synthesis of APL (also by Iverson) and the FP and FL function-level languages created by John Backus. To avoid repeating the APL special-character problem, J uses only the basic ASCII character set, resorting to the use of the dot and colon as inflections to form short words similar to digraphs. Most such "primary" (or "primitive") J words serve as mathematical symbols, with the dot or colon extending the meaning of the basic characters available. Also, many characters which in other languages often must be paired (such as [] {} "" `` or <>) are treated by J as stand-alone words or, when inflected, as single-character roots of multi-character words. J is a very terse array programming language, and is most suited to mathematical and statistical programming, especially when performing operations on matrices. It has also been used in extreme programming and network performance analysis. Like the original FP/FL languages, J supports function-level programming via its tacit programming features. Unlike most languages that support object-oriented programming, J's flexible hierarchical namespace scheme (where every name exists in a specific locale) can be effectively used as a framework for both class-based and prototype-based object-oriented programming. Since March 2011, J is free and open-source software under the GPLv3 license. One may also purchase source under a negotiated license. | https://en.wikipedia.org/wiki/J_(programming_language) |
| Isabelle | The Isabelle theorem prover is an interactive theorem prover, a Higher Order Logic (HOL) theorem prover. It is an LCF-style theorem prover (written in Standard ML), so it is based on a small logical core to ease logical correctness. Isabelle is generic: it provides a meta-logic (a weak type theory), which is used to encode object logics like first-order logic (FOL), higher-order logic (HOL) or Zermelo–Fraenkel set theory (ZFC). Isabelle's main proof method is a higher-order version of resolution, based on higher-order unification. Though interactive, Isabelle also features efficient automatic reasoning tools, such as a term rewriting engine and a tableaux prover, as well as various decision procedures. Isabelle has been used to formalize numerous theorems from mathematics and computer science, like Gödel's completeness theorem, Gödel's theorem about the consistency of the axiom of choice, the prime number theorem, correctness of security protocols, and properties of programming language semantics. The Isabelle theorem prover is free software, released under the revised BSD license. Isabelle was named by Lawrence Paulson after Gérard Huet's daughter. | https://en.wikipedia.org/wiki/Isabelle_(proof_assistant) |
| iCalendar | The Internet Calendaring and Scheduling Core Object Specification (iCalendar) is a MIME type which allows users to store and exchange calendaring and scheduling information such as events, to-dos, journal entries, and free/busy information. Files formatted according to the specification usually have an extension of .ics. With supporting software, such as an email reader or calendar application, recipients of an iCalendar data file can respond to the sender easily or counter-propose another meeting date/time. The file format is specified in a proposed internet standard (RFC 5545) for calendar data exchange.iCalendar is used and supported by many products, including Google Calendar, Apple Calendar (formerly iCal), IBM Notes (formerly Lotus Notes), Yahoo! Calendar, Evolution (software), eM Client, Lightning extension for Mozilla Thunderbird and SeaMonkey, and partially by Microsoft Outlook and Novell GroupWise. iCalendar is designed to be independent of the transport protocol. For example, certain events can be sent by traditional email or whole calendar files can be shared and edited by using a WebDav server, or SyncML. Simple web servers (using just the HTTP protocol) are often used to distribute iCalendar data about an event and to publish busy times of an individual. Publishers can embed iCalendar data in web pages using hCalendar, a 1:1 microformat representation of iCalendar in semantic (X)HTML. | https://en.wikipedia.org/wiki/iCalendar |
| SI | The International System of Units (abbreviated as SI, from the French Système international (d'unités)) is the modern form of the metric system, and is the most widely used system of measurement. It comprises a coherent system of units of measurement built on seven base units and a set of twenty prefixes to the unit names and unit symbols that may be used when specifying multiples and fractions of the units. The system also specifies lowercase names for 22 derived units. The system was published in 1960 as a result of an initiative that began in 1948. It is based on the metre–kilogram–second system of units (MKS) rather than any variant of the centimetre–gram–second system of units (CGS). SI is intended to be an evolving system, so prefixes and units are created and unit definitions are modified through international agreement as the technology of measurement progresses and the precision of measurements improves. The 24th and 25th General Conferences on Weights and Measures (CGPM) in 2011 and 2014, for example, discussed a proposal to change the definition of the kilogram, linking it to an invariant of nature rather than to the mass of a material artefact, thereby ensuring long-term stability. The motivation for the development of the SI was the diversity of units that had sprung up within the CGS systems and the lack of coordination between the various disciplines that used them. The CGPM, which was established by the Metre Convention of 1875, brought together many international organisations to not only agree on the definitions and standards of the new system but also agree on the rules for writing and presenting measurements in a standardised manner around the world. The International System of Units has been adopted by all developed countries except the United States. | https://en.wikipedia.org/wiki/International_System_of_Units |
| International System of Quantities | The International System of Quantities (ISQ) is a system based on seven base quantities: length, mass, time, electric current, thermodynamic temperature, amount of substance, and luminous intensity. Other quantities such as area, pressure, and electrical resistance are derived from these base quantities by clear, non-contradictory equations. The ISQ defines the quantities that are measured with the SI units and also includes many other quantities in modern science and technology. The ISQ is defined in the international standard ISO/IEC 80000, and was finalised in 2009 with the publication of ISO 80000-1. The 14 parts of ISO/IEC 80000 define quantities used in scientific disciplines such as mechanics (e.g., pressure), light, acoustics (e.g., sound pressure), electromagnetism, information technology (e.g., storage capacity), chemistry, mathematics (e.g., Fourier transform), and physiology. | https://en.wikipedia.org/wiki/International_System_of_Quantities |
| International Chemical Identifier | The IUPAC International Chemical Identifier (InChI IN-chee or ING-kee) is a textual identifier for chemical substances, designed to provide a standard way to encode molecular information and to facilitate the search for such information in databases and on the web. Initially developed by IUPAC (International Union of Pure and Applied Chemistry) and NIST (National Institute of Standards and Technology) from 2000 to 2005, the format and algorithms are non-proprietary. The continuing development of the standard has been supported since 2010 by the not-for-profit InChI Trust, of which IUPAC is a member. The current software version is 1.05 and was released in January 2017. Prior to 1.04, the software was freely available under the open-source LGPL license, but it now uses a custom license called IUPAC-InChI Trust License. | https://en.wikipedia.org/wiki/International_Chemical_Identifier |
| Ini | The INI file format is an informal standard for configuration files for some platforms or software. INI files are simple text files with a basic structure composed of sections, properties, and values. In MS-DOS and 16-bit Windows platforms up through Windows ME, the INI file served as the primary mechanism to configure operating system and installed applications features, such as device drivers, fonts, startup launchers, and things that needed to be initialized in booting Windows. INI files were also generally used by applications to store their individual settings. Starting with Windows NT, Microsoft favored the use of the registry, and began to steer developers away from using INI files for configuration. All subsequent versions of Windows have used the Windows Registry for system configuration, and applications built on the .NET Framework use special XML .config files. The APIs still exist in Windows, however, and developers may still use them. The name "INI file" comes from the commonly used filename extension .INI, which stands for "initialization". Other common initialization file extensions are .CFG, .conf, and .TXT, especially CONFIG.SYS and 'config.txt' occurrences. Linux and Unix systems also use a similar file format for system configuration. In addition, platform-agnostic software may use this file format for configuration. It is human-readable and simple to parse, so it is a usable format for configuration files that do not require much greater complexity. For example, the platform-agnostic PHP uses the INI format for its "php.ini" configuration file in both Windows and Linux systems. Desktop.ini files determine how a folder is displayed by Windows, such as the icon used by that folder. | https://en.wikipedia.org/wiki/INI_file |
| Intuit Interchange Format | The IIF file format, Intuit Interchange Format is a proprietary text file used by Intuit's Quickbooks software for importing and exporting lists and transactions. As of 2004, QuickBooks can also import data using the XML-based qbXML file exchange format. The MIME‑types associated with .iif files are application/qbooks, application/qbookspro, and text/iif. | https://en.wikipedia.org/wiki/Intuit_Interchange_Format |
| IBM i Control Language | The IBM i Control Language (CL) is a scripting language for the IBM's IBM i platform (previously called OS/400 when running on AS/400 systems) bearing a resemblance to the IBM Job Control Language and consisting of an ever-expanding set of command objects (*CMD) used to invoke traditional AS/400 programs and/or get help on what those programs do. CL can also be used to create CL programs (congruent to shell scripts) where there are additional commands that provide program-like functionality (IF/ELSE, variable declaration, file input, etc.) Although CL is a scripting language for system administration, it is used mainly to create compiled programs. The use of interpreted CL scripts through the SBMDBJOB command is in fact extremely limited. While thousands of commands were written by IBM developers to perform system level tasks like compiling programs, backing up data, changing system configurations, displaying system object details, or deleting them, commands are not limited to systems level concerns and can be drafted for user applications as well. | https://en.wikipedia.org/wiki/IBM_i_Control_Language |
| IBM BASICA | The IBM Personal Computer Basic, commonly shortened to IBM BASIC, is a programming language first released by IBM with the IBM Personal Computer (model 5150) in 1981. IBM released four different versions of the Microsoft BASIC interpreter, licensed from Microsoft for the PC and PCjr. They are known as Cassette BASIC, Disk BASIC, Advanced BASIC (BASICA), and Cartridge BASIC. Versions of Disk BASIC and Advanced BASIC were included with IBM PC DOS up to PC DOS 4. In addition to the features of an ANSI standard BASIC, the IBM versions offered support for the graphics and sound hardware of the IBM PC line. Source code could be typed in with a full screen editor, and very limited facilities were provided for rudimentary program debugging. IBM also released a version of the Microsoft BASIC compiler for the PC, concurrently with the release of PC DOS 1.10 in 1982. | https://en.wikipedia.org/wiki/IBM_BASICA |
| IBM BASIC | The IBM Personal Computer Basic, commonly shortened to IBM BASIC, is a programming language first released by IBM with the IBM Personal Computer (model 5150) in 1981. IBM released four different versions of the Microsoft BASIC interpreter, licensed from Microsoft for the PC and PCjr. They are known as Cassette BASIC, Disk BASIC, Advanced BASIC (BASICA), and Cartridge BASIC. Versions of Disk BASIC and Advanced BASIC were included with IBM PC DOS up to PC DOS 4. In addition to the features of an ANSI standard BASIC, the IBM versions offered support for the graphics and sound hardware of the IBM PC line. Source code could be typed in with a full screen editor, and very limited facilities were provided for rudimentary program debugging. IBM also released a version of the Microsoft BASIC compiler for the PC, concurrently with the release of PC DOS 1.10 in 1982. | https://en.wikipedia.org/wiki/IBM_BASIC |
| IBM POWER Instruction Set Architecture | The IBM POWER ISA is a reduced instruction set computer (RISC) instruction set architecture (ISA) developed by IBM. The name is an acronym for Performance Optimization With Enhanced RISC. The ISA is used as base for high end microprocessors from IBM during the 1990s and were used in many of IBM's servers, minicomputers, workstations, and supercomputers. These processors are called POWER1 (RIOS-1, RIOS.9, RSC, RAD6000) and POWER2 (POWER2, POWER2+ and P2SC). The ISA evolved into the PowerPC instruction set architecture and was deprecated in 1998 when IBM introduced the POWER3 processor that was mainly a 32/64 bit PowerPC processor but included the POWER ISA for backwards compatibility. The POWER ISA was then abandoned. | https://en.wikipedia.org/wiki/IBM_POWER_Instruction_Set_Architecture |
| IBM 1620 | The IBM 1620 was announced by IBM on October 21, 1959, and marketed as an inexpensive "scientific computer". After a total production of about two thousand machines, it was withdrawn on November 19, 1970. Modified versions of the 1620 were used as the CPU of the IBM 1710 and IBM 1720 Industrial Process Control Systems (making it the first digital computer considered reliable enough for real-time process control of factory equipment). Being variable word length decimal, as opposed to fixed-word-length pure binary, made it an especially attractive first computer to learn on – and hundreds of thousands of students had their first experiences with a computer on the IBM 1620. Core memory cycle times were 20 microseconds for the (earlier) Model I, 10 microseconds for the Model II (about a thousand times slower than typical computer main memory in 2006). The Model II was introduced in 1962. | https://en.wikipedia.org/wiki/IBM_1620 |
| IBM 1401 Symbolic Programming System | The IBM 1401 Symbolic Programming System (SPS) was an assembler that was developed by Gary Mokotoff, IBM Applied Programming Department, for the IBM 1401 computer, the first of the IBM 1400 series. One source indicates that "This programming system was announced by IBM with the machine."SPS-1 could run on a low-end machine with 1.4K memory, SPS-2 required at least 4K memory. SPS-1 punched one card for each input instruction in its first pass and this deck had to be read during pass 2. At the University of Chicago and many other locations, SPS-1 was replaced by assemblers taking advantage of the commonly available 4K memory configuration to pack the output of pass one into several instructions per card. Other assemblers were written which placed the pass one output into memory for small programs.As the 1400 series matured additional assemblers, programming languages and report generators became available, replacing SPS in most sites. | https://en.wikipedia.org/wiki/IBM_1401_Symbolic_Programming_System |
| HTTP | The Hypertext Transfer Protocol (HTTP) is an application protocol for distributed, collaborative, and hypermedia information systems. HTTP is the foundation of data communication for the World Wide Web. Hypertext is structured text that uses logical links (hyperlinks) between nodes containing text. HTTP is the protocol to exchange or transfer hypertext. Development of HTTP was initiated by Tim Berners-Lee at CERN in 1989. Standards development of HTTP was coordinated by the Internet Engineering Task Force (IETF) and the World Wide Web Consortium (W3C), culminating in the publication of a series of Requests for Comments (RFCs). The first definition of HTTP/1.1, the version of HTTP in common use, occurred in RFC 2068 in 1997, although this was obsoleted by RFC 2616 in 1999 and then again by the RFC 7230 family of RFCs in 2014. A later version, the successor HTTP/2, was standardized in 2015, and is now supported by major web servers and browsers over TLS using ALPN extension where TLS 1.2 or newer is required. | https://en.wikipedia.org/wiki/Hypertext_Transfer_Protocol |
| Hindu-Arabic numeral system | The Hindu–Arabic numeral system or Indo-Arabic numeral system (also called the Arabic numeral system or Hindu numeral system) is a positional decimal numeral system, and is the most common system for the symbolic representation of numbers in the world. It was invented between the 1st and 4th centuries by Indian mathematicians. The system was adopted in Arabic mathematics by the 9th century. Influential were the books of Muḥammad ibn Mūsā al-Khwārizmī (On the Calculation with Hindu Numerals, c. 825) and Al-Kindi (On the Use of the Hindu Numerals, c. 830). The system later spread to medieval Europe by the High Middle Ages. The system is based upon ten (originally nine) glyphs. The symbols (glyphs) used to represent the system are in principle independent of the system itself. The glyphs in actual use are descended from Brahmi numerals and have split into various typographical variants since the Middle Ages. These symbol sets can be divided into three main families: Western Arabic numerals used in the Greater Maghreb and in Europe, Eastern Arabic numerals (also called "Indic numerals") used in the Middle East, and the Indian numerals used in the Indian subcontinent. | https://en.wikipedia.org/wiki/Hindu–Arabic_numeral_system |
| HLSL | The High-Level Shader Language or High-Level Shading Language (HLSL) is a proprietary shading language developed by Microsoft for the Direct3D 9 API to augment the shader assembly language, and went on to become the required shading language for the unified shader model of Direct3D 10 and higher. HLSL is analogous to the GLSL shading language used with the OpenGL standard. It is very similar to the Nvidia Cg shading language, as it was developed alongside it. HLSL shaders can enable profound speed and detail increases as well as many special effects in both 2d and 3d computer graphics.HLSL programs come in five forms: pixel shaders (fragment in GLSL), vertex shaders, geometry shaders, compute shaders and tessellation shaders (Hull and Domain shaders). A vertex shader is executed for each vertex that is submitted by the application, and is primarily responsible for transforming the vertex from object space to view space, generating texture coordinates, and calculating lighting coefficients such as the vertex's tangent, binormal and normal vectors. When a group of vertices (normally 3, to form a triangle) come through the vertex shader, their output position is interpolated to form pixels within its area; this process is known as rasterisation. Each of these pixels comes through the pixel shader, whereby the resultant screen colour is calculated. Optionally, an application using a Direct3D 10/11/12 interface and Direct3D 10/11/12 hardware may also specify a geometry shader. This shader takes as its input some vertices of a primitive (triangle/line/point) and uses this data to generate/degenerate (or tessellate) additional primitives or to change the type of primitives, which are each then sent to the rasterizer. D3D11.3 and D3D12 introduced Shader Model 5.1 and later 6.0. | https://en.wikipedia.org/wiki/High-Level_Shading_Language |
| Harwell-Boeing file format | The Harwell-Boeing file format (also known as HB format) is a file format designed to store information used to describe sparse matrices. | https://en.wikipedia.org/wiki/Harwell-Boeing_file_format |
| Clinical Document Architecture | The HL7 Clinical Document Architecture (CDA) is an XML-based markup standard intended to specify the encoding, structure and semantics of clinical documents for exchange. In November 2000, HL7 published Release 1.0. The organization published Release 2.0 with its "2005 Normative Edition." | https://en.wikipedia.org/wiki/Clinical_Document_Architecture |
| GIF | The Graphics Interchange Format (GIF JIF or GHIF), is a bitmap image format that was developed by a team at the online services provider CompuServe led by American computer scientist Steve Wilhite on June 15, 1987. It has since come into widespread usage on the World Wide Web due to its wide support and portability between many applications and operating systems. The format supports up to 8 bits per pixel for each image, allowing a single image to reference its own palette of up to 256 different colors chosen from the 24-bit RGB color space. It also supports animations and allows a separate palette of up to 256 colors for each frame. These palette limitations make GIF less suitable for reproducing color photographs and other images with color gradients, but it is well-suited for simpler images such as graphics or logos with solid areas of color. GIF images are compressed using the Lempel–Ziv–Welch (LZW) lossless data compression technique to reduce the file size without degrading the visual quality. This compression technique was patented in 1985. Controversy over the licensing agreement between the software patent holder, Unisys, and CompuServe in 1994 spurred the development of the Portable Network Graphics (PNG) standard. By 2004 all the relevant patents had expired. | https://en.wikipedia.org/wiki/GIF |
| Gopher | The Gopher protocol is a TCP/IP application layer protocol designed for distributing, searching, and retrieving documents over the Internet. The Gopher protocol was strongly oriented towards a menu-document design and presented an alternative to the World Wide Web in its early stages, but ultimately Hypertext Transfer Protocol (HTTP) became the dominant protocol. The Gopher ecosystem is often regarded as the effective predecessor of the World Wide Web.The protocol was invented by a team led by Mark P. McCahill at the University of Minnesota. It offers some features not natively supported by the Web and imposes a much stronger hierarchy on information stored on it. Its text menu interface is well-suited to computing environments that rely heavily on remote text-oriented computer terminals, which were still common at the time of its creation in 1991, and the simplicity of its protocol facilitated a wide variety of client implementations. More recent Gopher revisions and graphical clients added support for multimedia. Gopher was preferred by many network administrators for using fewer network resources than Web services.Gopher's hierarchical structure provided a platform for the first large-scale electronic library connections. Gopher has been described by some enthusiasts as "faster and more efficient and so much more organized" than today's Web services. The Gopher protocol is still in use by enthusiasts, and although it has been almost entirely supplanted by the Web, a small population of actively-maintained servers remains. | https://en.wikipedia.org/wiki/Gopher_(protocol) |
| Glyph Bitmap Distribution Format | The Glyph Bitmap Distribution Format (BDF) by Adobe is a file format for storing bitmap fonts. The content takes the form of a text file intended to be human- and computer-readable. BDF is typically used in Unix X Window environments. It has largely been replaced by the PCF font format which is somewhat more efficient, and by scalable fonts such as OpenType and TrueType fonts. | https://en.wikipedia.org/wiki/Glyph_Bitmap_Distribution_Format |
| Gerber Image | The Gerber format is an open ASCII vector format for 2D binary images. It is the de facto standard used by printed circuit board (PCB) industry software to describe the printed circuit board images: copper layers, solder mask, legend, etc.Gerber is used in PCB fabrication data. PCBs are designed on a specialized electronic design automation (EDA) or a computer-aided design (CAD) system. The CAD systems output PCB fabrication data to allow fabrication of the board. This data typically contains a Gerber file for each image layer (copper layers, solder mask, legend or silk...). Gerber is also the standard image input format for all bare board fabrication equipment needing image data, such as photoplotters, legend printers, direct imagers or automated optical inspection (AOI) machines and for viewing reference images in different departments. For assembly the fabrication data contains the solder paste layers and the central locations of components to create the stencil and place and bond the components.There are two major generations of Gerber format: Extended Gerber, or RS-274X. This is the current Gerber format. In 2014, the graphics format was extended with the option to add meta-information to the graphics objects. Files with attributes are called X2 files, without X1 files. Standard Gerber, or RS-274-D. This obsolete format was revoked.The standard file extension is .GBR or .gbr though other extensions are also used. | https://en.wikipedia.org/wiki/Gerber_format |
| Geography Markup Language | The Geography Markup Language (GML) is the XML grammar defined by the Open Geospatial Consortium (OGC) to express geographical features. GML serves as a modeling language for geographic systems as well as an open interchange format for geographic transactions on the Internet. Key to GML's utility is its ability to integrate all forms of geographic information, including not only conventional "vector" or discrete objects, but coverages (see also GMLJP2) and sensor data. | https://en.wikipedia.org/wiki/Geography_Markup_Language |
| GAMS | The General Algebraic Modeling System (GAMS) is a high-level modeling system for mathematical optimization. GAMS is designed for modeling and solving linear, nonlinear, and mixed-integer optimization problems. The system is tailored for complex, large-scale modeling applications and allows the user to build large maintainable models that can be adapted to new situations. The system is available for use on various computer platforms. Models are portable from one platform to another. GAMS was the first algebraic modeling language (AML) and is formally similar to commonly used fourth-generation programming languages. GAMS contains an integrated development environment (IDE) and is connected to a group of third-party optimization solvers. Among these solvers are BARON, COIN-OR solvers, CONOPT, CPLEX, DICOPT, Gurobi, MOSEK, SNOPT, SULUM, and XPRESS. GAMS allows the users to implement a sort of hybrid algorithm combining different solvers. Models are described in concise, human-readable algebraic statements. GAMS is among the most popular input formats for the NEOS Server. Although initially designed for applications related to economics and management science, it has a community of users from various backgrounds of engineering and science. | https://en.wikipedia.org/wiki/General_Algebraic_Modeling_System |
| Gene transfer format | The Gene transfer format (GTF) is a file format used to hold information about gene structure. It is a tab-delimited text format based on the general feature format (GFF), but contains some additional conventions specific to gene information. A significant feature of the GTF that can be validated: given a sequence and a GTF file, one can check that the format is correct. This significantly reduces problems with the interchange of data between groups. | https://en.wikipedia.org/wiki/Gene_transfer_format |
| DarkBASIC | The Game Creators Ltd (formerly Dark Basic Software Limited) is a British software house based in Macclesfield, England, which specialises in software for video game development. The company was established in March 1999 through a partnership between programmers Lee Bamber and Richard Vanner. | https://en.wikipedia.org/wiki/DarkBASIC |
| GDB | The GNU Debugger (GDB) is a portable debugger that runs on many Unix-like systems and works for many programming languages, including Ada, C, C++, Objective-C, Free Pascal, Fortran, Java and partially others. | https://en.wikipedia.org/wiki/GNU_Debugger |
| GNU Data Language | The GNU Data Language (GDL) is a free alternative to IDL (Interactive Data Language). Together with its library routines, GDL is developed to serve as a tool for data analysis and visualization in such disciplines as astronomy, geosciences, and medical imaging. GDL is licensed under the GPL. Other open-source numerical data analysis tools similar to GDL include GNU Octave, NCAR Command Language (NCL), Perl Data Language (PDL), R, Scilab, SciPy, and Yorick. GDL as a language is dynamically-typed, vectorized, and has object-oriented programming capabilities. GDL library routines handle numerical calculations (e.g. FFT), data visualisation, signal/image processing, interaction with host OS, and data input/output. GDL supports several data formats, such as NetCDF, HDF (v4 & v5), GRIB, PNG, TIFF, and DICOM. Graphical output is handled by X11, PostScript, SVG, or z-buffer terminals, the last one allowing output graphics (plots) to be saved in raster graphics formats. GDL features integrated debugging facilities, such as breakpoints. GDL has a Python bridge (Python code can be called from GDL; GDL can be compiled as a Python module). GDL uses Eigen (C++ library) numerical library (similar to Intel MKL) to have excellent computing performance on multi-cores processors, with better benchmark than IDL on large matrix operations. Packaged versions of GDL are available for several Linux and BSD flavours as well as Mac OS X. The source code compiles on Microsoft Windows (since GDL 0.9.3) and other UNIX systems, including Solaris. GDL is not an official GNU package. | https://en.wikipedia.org/wiki/GNU_Data_Language |
| GNU Assembler | The GNU Assembler, commonly known as gas or simply as, its executable name, is the assembler used by the GNU Project. It is the default back-end of GCC. It is used to assemble the GNU operating system and the Linux kernel, and various other software. It is a part of the GNU Binutils package. The GAS executable is named as, the standard name for a Unix assembler. GAS is cross-platform, and both runs on and assembles for a number of different computer architectures. Released under the GNU General Public License v3, GAS is free software. | https://en.wikipedia.org/wiki/GNU_Assembler |
| Gello Expression Language | The GELLO Expression Language was started in 2001 and introduced in 2002; in 2005, GELLO was adopted as an international standard by Health Level Seven International and ANSI for a decision support language. GELLO Release 2 was completed and approved by ANSI in June 2010. The GELLO specifications have been developed in coordination with the HL7 Clinical Decision Support TC (CDSTC)GELLO is a class-based object-oriented programming language and a relative of the Object Constraint Language (OCL). OCL is a well-developed constraint language that makes it attractive for use as an expression language. The intention was for GELLO to evolve as a standard query and expression language for decision support.GELLO creates the potential for many decision support options, as the full array of atomic patient data is greatly accessible to complement better, safer clinical decision making by health professionals. Furthermore, this enables specialist clinicians to customize their current systems and create flexible purpose built decision support systems.Standardization of GELLO it has made this language compatible with the HL7 version 3.0 Reference Information Model (RIM). GELLO uses an abstract "virtual medical record" (vMR) so that the same GELLO code can run on multiple systems accessing data stored in different formats. The vMR is a simplified view of the HL7 RIM.The current focus of the HL7 CDS WG is to build on the Clinical Quality Language (CQL) | https://en.wikipedia.org/wiki/Gello_Expression_Language |
| Function block diagram | The Function Block Diagram (FBD) is a graphical language for programmable logic controller design, that can describe the function between input variables and output variables. A function is described as a set of elementary blocks. Input and output variables are connected to blocks by connection lines. Inputs and outputs of the blocks are wired together with connection lines, or links. Single lines may be used to connect two logical points of the diagram: An input variable and an input of a block An output of a block and an input of another block An output of a block and an output variableThe connection is oriented, meaning that the line carries associated data from the left end to the right end. The left and right ends of the connection line must be of the same type. Multiple right connection, also called divergence can be used to broadcast information from its left end to each of its right ends. All ends of the connection must be of the same type. Function Block Diagram is one of five languages for logic or control configuration supported by standard IEC 61131-3 for a control system such as a Programmable Logic Controller (PLC) or a Distributed Control System (DCS). The other supported languages are ladder logic, sequential function chart, structured text, and instruction list. | https://en.wikipedia.org/wiki/Function_block_diagram |
| Formula language | The Formula language is a scripting language used by Lotus Notes. It is often referred to as @Formula language (pronounced at-formula) because many language elements start with the @-character. Here is an example of a selection formula: SELECT @NoteId = "NT0050D26" It was created by Ray Ozzie during the early development of Lotus Notes. He borrowed the compiler and decompiler from the Lotus 1-2-3 spreadsheet, but unlike the spreadsheet language Formula Language was designed primarily for string and list processing, not numerical processing. It was originally a Functional programming language with unique text list-handling features inspired by Ray Ozzie's prior use of Icon and Lisp. The Formula language engine was rewritten by Damien Katz for Notes and Domino 6. New features were added to the language, such as looping and dynamic execution, and performance was improved.The Formula language has two parts: @Functions for calculations and simple logic @Commands for performing actions in the user interface@Functions can be used in several places throughout Lotus Notes. The most important uses are: to select documents to show to the user in a view (a kind of index) or to select documents for further processing. In this case, the formula will evaluate to a 'true' (selected) or 'false' value (not selected) for each document. to provide default values for fields, to transform the data entered by the user (like stripping off redundant spaces) and to validate this data. to get a list of values from a Notes database or even from a relational database (using ODBC). This may be used to provide a user with a list of values to choose from. to process a set of documents. The formula is placed in an agent, a program or macro that can be started by a user or by the Notes server according to a schedule. When the agent is triggered, the formula executes for each selected document (this a very limited form of a loop). This is an efficient way of changing lots of documents, if the logic is not too complicated. In case of complicated changes, LotusScript is used.@Commands are like menu commands: they perform actions in the Lotus Notes client. Examples of actions are: opening a Notes database creating an e-mail putting the cursor in a specific data-entry field closing a window starting an agent@Commands are primarily used in formulas that are triggered by user action, such as in button formulas. It is possible to combine them with @Functions, for example by making execution of an @command conditional on a field value. | https://en.wikipedia.org/wiki/Formula_language |
| FTP | The File Transfer Protocol (FTP) is the standard network protocol used for the transfer of computer files between a client and server on a computer network. FTP is built on a client-server model architecture and uses separate control and data connections between the client and the server. FTP users may authenticate themselves with a clear-text sign-in protocol, normally in the form of a username and password, but can connect anonymously if the server is configured to allow it. For secure transmission that protects the username and password, and encrypts the content, FTP is often secured with SSL/TLS (FTPS). SSH File Transfer Protocol (SFTP) is sometimes also used instead; it is technologically different. The first FTP client applications were command-line programs developed before operating systems had graphical user interfaces, and are still shipped with most Windows, Unix, and Linux operating systems. Many FTP clients and automation utilities have since been developed for desktops, servers, mobile devices, and hardware, and FTP has been incorporated into productivity applications, such as web page editors. | https://en.wikipedia.org/wiki/File_Transfer_Protocol |
| Extensible Embeddable Language | The Extensible Embeddable Language (EEL) is a scripting and programming language in development by David Olofson. EEL is intended for scripting in realtime systems with cycle rates in the kHz range, such as musical synthesizers and industrial control systems, but also aspires to be usable as a platform independent general purpose programming language. | https://en.wikipedia.org/wiki/Extensible_Embeddable_Language |
| Energy Systems Language | The Energy Systems Language, also referred to as Energese, Energy Circuit Language, or Generic Systems Symbols, was developed by the ecologist Howard T. Odum and colleagues in the 1950s during studies of the tropical forests funded by the United States Atomic Energy Commission. They are used to compose energy flow diagrams in the field of systems ecology. | https://en.wikipedia.org/wiki/Energy_Systems_Language |
| DNS | The Domain Name System (DNS) is a hierarchical and decentralized naming system for computers, services, or other resources connected to the Internet or a private network. It associates various information with domain names assigned to each of the participating entities. Most prominently, it translates more readily memorized domain names to the numerical IP addresses needed for locating and identifying computer services and devices with the underlying network protocols. By providing a worldwide, distributed directory service, the Domain Name System has been an essential component of the functionality of the Internet since 1985. The Domain Name System delegates the responsibility of assigning domain names and mapping those names to Internet resources by designating authoritative name servers for each domain. Network administrators may delegate authority over sub-domains of their allocated name space to other name servers. This mechanism provides distributed and fault-tolerant service and was designed to avoid a single large central database. The Domain Name System also specifies the technical functionality of the database service that is at its core. It defines the DNS protocol, a detailed specification of the data structures and data communication exchanges used in the DNS, as part of the Internet Protocol Suite. The Internet maintains two principal namespaces, the domain name hierarchy and the Internet Protocol (IP) address spaces. The Domain Name System maintains the domain name hierarchy and provides translation services between it and the address spaces. Internet name servers and a communication protocol implement the Domain Name System. A DNS name server is a server that stores the DNS records for a domain; a DNS name server responds with answers to queries against its database. The most common types of records stored in the DNS database are for Start of Authority (SOA), IP addresses (A and AAAA), SMTP mail exchangers (MX), name servers (NS), pointers for reverse DNS lookups (PTR), and domain name aliases (CNAME). Although not intended to be a general purpose database, DNS has been expanded over time to store records for other types of data for either automatic lookups, such as DNSSEC records, or for human queries such as responsible person (RP) records. As a general purpose database, the DNS has also been used in combating unsolicited email (spam) by storing a real-time blackhole list (RBL). The DNS database is traditionally stored in a structured text file, the zone file, but other database systems are common. | https://en.wikipedia.org/wiki/Domain_Name_System |
| Distributed Application Specification Language | The DASL Programming Language (Distributed Application Specification Language) is a high-level, strongly typed programming language originally developed at Sun Microsystems Laboratories between 1999 and 2003 as part of the Ace Project. The goals of the project were to enable rapid development of web-based applications based on Sun's J2EE architecture, and to eliminate the steep learning curve of platform-specific details. DASL defines an application as a domain model with one or more logical presentation models, where a logical presentation model consists of a choreography of the domain model objects described in a set of forms with attached actions. DASL generates the graphical user interface directly from the logical presentation. DASL is unique among modern application programming languages in its ability to generate a modern graphic user interface for an application without requiring the programmer to define the user interface explicitly, while allowing the programmer to control the look and feel of the generated graphic user interface. The DASL language is partially declarative and partially procedural. Description of object/data structures and persistence, and the description of the logical presentation, are declarative. Basic object constraints and behavior are declarative, while additional object behaviors are specified procedurally as methods. Queries can be defined either declaratively or by writing methods. The language and development environment are a practical realization of the model-driven architecture (MDA) approach. The programmer uses DASL to produce the platform-independent model or PIM, and the language code generators automatically produce and deploy the platform-specific model or PSM. New PSMs may be introduced by writing new code generators. | https://en.wikipedia.org/wiki/Distributed_Application_Specification_Language |
| DARPA Agent Markup Language | The DARPA Agent Markup Language (DAML) was the name of a US funding program at the US Defense Advanced Research Projects Agency (DARPA) started in 1999 by then-Program Manager James Hendler, and later run by Murray Burke, Mark Greaves and Michael Pagels. The program focused on the creation of machine-readable representations for the Web. One of the Investigators working on the program was Tim Berners-Lee and to a great degree through his influence, working with the program managers, the effort worked to create technologies and demonstrations for what is now called the Semantic Web and this in turn led to the growth of Knowledge Graph technology. A primary outcome of the DAML program was the DAML language, an agent markup language based on RDF. This language was then followed by an extension entitled DAML+OIL which included researchers outside of the DARPA program in the design. The 2002 submission of the DAML+OIL language to the World Wide Web Consortium (W3C) captures the work done by DAML contractors and the EU/U.S. ad hoc Joint Committee on Markup Languages. This submission was the starting point for the language (later called OWL) to be developed by W3C's web ontology working group, WebOnt. DAML+OIL was a syntax, layered on RDF and XML, that could be used to describe sets of facts making up an ontology. DAML+OIL had its roots in three main languages - DAML, as described above, OIL (Ontology Inference Layer) and SHOE, an earlier US research project. A major innovation of the languages was to use RDF and XML for a basis, and to use RDF namespaces to organize and assist with the integration of arbitrarily many different and incompatible ontologies. Articulation ontologies can link these competing ontologies through codification of analogous subsets in a neutral point of view, as is done in the Wikipedia. Current ontology research derived in part from DAML is leading toward the expression of ontologies and rules for reasoning and action. Much of the work in DAML has now been incorporated into RDF Schema, the OWL and their successor languages and technologies including schema.org | https://en.wikipedia.org/wiki/DARPA_Agent_Markup_Language |
| D | The D programming language is an object-oriented, imperative, multi-paradigm system programming language created by Walter Bright of Digital Mars and released in 2001. Bright was joined in the design and development effort in 2007 by Andrei Alexandrescu. Though it originated as a re-engineering of C++, D is a distinct language, having redesigned some core C++ features while also taking inspiration from other languages, notably Java, Python, Ruby, C#, and Eiffel. D's design goals attempt to combine the performance and safety of compiled languages with the expressive power of modern dynamic languages. Idiomatic D code is commonly as fast as equivalent C++ code, while being shorter and memory-safe. Type inference, automatic memory management and syntactic sugar for common types allow faster development, while bounds checking, design by contract features and a concurrency-aware type system help reduce the occurrence of bugs. | https://en.wikipedia.org/wiki/D_(programming_language) |
| Cyclone | The Cyclone programming language is intended to be a safe dialect of the C language. Cyclone is designed to avoid buffer overflows and other vulnerabilities that are possible in C programs, without losing the power and convenience of C as a tool for system programming. Cyclone development was started as a joint project of AT&T Labs Research and Greg Morrisett's group at Cornell in 2001. Version 1.0 was released on May 8, 2006. | https://en.wikipedia.org/wiki/Cyclone_(programming_language) |
| Continuity of Care Document | The Continuity of Care Document (CCD) specification is an XML-based markup standard intended to specify the encoding, structure, and semantics of a patient summary clinical document for exchange. | https://en.wikipedia.org/wiki/Continuity_of_Care_Document |
| INTERCAL | The Compiler Language With No Pronounceable Acronym, abbreviated INTERCAL, is an esoteric programming language that was created as a parody by Don Woods and James M. Lyon, two Princeton University students, in 1972. It satirizes aspects of the various programming languages at the time, as well as the proliferation of proposed language constructs and notations in the 1960s. There are two currently maintained versions of INTERCAL: C-INTERCAL, maintained by Eric S. Raymond, and CLC-INTERCAL, maintained by Claudio Calvelli. | https://en.wikipedia.org/wiki/INTERCAL |
| Common Object File Format | The Common Object File Format (COFF) is a format for executable, object code, and shared library computer files used on Unix systems. It was introduced in Unix System V, replaced the previously used a.out format, and formed the basis for extended specifications such as XCOFF and ECOFF, before being largely replaced by ELF, introduced with SVR4. COFF and its variants continue to be used on some Unix-like systems, on Microsoft Windows, in EFI environments and in some embedded development systems. | https://en.wikipedia.org/wiki/COFF |
| CLOS | The Common Lisp Object System (CLOS) is the facility for object-oriented programming which is part of ANSI Common Lisp. CLOS is a powerful dynamic object system which differs radically from the OOP facilities found in more static languages such as C++ or Java. CLOS was inspired by earlier Lisp object systems such as MIT Flavors and CommonLoops, although it is more general than either. Originally proposed as an add-on, CLOS was adopted as part of the ANSI standard for Common Lisp and has been adapted into other Lisp dialects such as EuLisp or Emacs Lisp. | https://en.wikipedia.org/wiki/CLOS |
| C shell | The C shell (csh or the improved version, tcsh) is a Unix shell created by Bill Joy while he was a graduate student at University of California, Berkeley in the late 1970s. It has been widely distributed, beginning with the 2BSD release of the Berkeley Software Distribution (BSD) that Joy began distributing in 1978. Other early contributors to the ideas or the code were Michael Ubell, Eric Allman, Mike O'Brien and Jim Kulp. The C shell is a command processor typically run in a text window, allowing the user to type commands. The C shell can also read commands from a file, called a script. Like all Unix shells, it supports filename wildcarding, piping, here documents, command substitution, variables and control structures for condition-testing and iteration. What differentiated the C shell from others, especially in the 1980s, were its interactive features and overall style. Its new features made it easier and faster to use. The overall style of the language looked more like C and was seen as more readable. On many systems, such as Mac OS X and Red Hat Linux, csh is actually tcsh, an improved version of csh. Often one of the two files is either a hard link or a symbolic link to the other, so that either name refers to the same improved version of the C shell. On Debian and some derivatives (including Ubuntu), there are two different packages: csh and tcsh. The former is based on the original BSD version of csh and the latter is the improved tcsh. tcsh added filename and command completion and command line editing concepts borrowed from the Tenex system, which is the source of the "t". Because it only added functionality and did not change what was there, tcsh remained backward compatible with the original C shell. Though it started as a side branch from the original source tree Joy had created, tcsh is now the main branch for ongoing development. tcsh is very stable but new releases continue to appear roughly once a year, consisting mostly of minor bug fixes. | https://en.wikipedia.org/wiki/C_Shell |
| Bourne shell | The Bourne shell (sh) is a shell, or command-line interpreter, for computer operating systems. The Bourne shell was the default shell for Version 7 Unix. Most Unix-like systems continue to have /bin/sh—which will be the Bourne shell, or a symbolic link or hard link to a compatible shell—even when other shells are used by most users. Developed by Stephen Bourne at Bell Labs, it was a replacement for the Thompson shell, whose executable file had the same name—sh. It was released in 1977 in the Version 7 Unix release distributed to colleges and universities. Although it is used as an interactive command interpreter, it was also intended as a scripting language and contains most of the features that are commonly considered to produce structured programs. It gained popularity with the publication of The Unix Programming Environment by Brian Kernighan and Rob Pike—the first commercially published book that presented the shell as a programming language in a tutorial form. | https://en.wikipedia.org/wiki/Bourne_shell |
| 20-GATE | The Bendix G-20 computer was introduced in 1961 by the Bendix Corporation, Computer Division, Los Angeles, California. The G-20 followed the highly successful G-15 vacuum tube computer. Bendix sold its computer division to Control Data Corporation in 1963, effectively terminating the G-20. | https://en.wikipedia.org/wiki/20-GATE |
| BMP file format | The BMP file format, also known as bitmap image file or device independent bitmap (DIB) file format or simply a bitmap, is a raster graphics image file format used to store bitmap digital images, independently of the display device (such as a graphics adapter), especially on Microsoft Windows and OS/2 operating systems. The BMP file format is capable of storing two-dimensional digital images both monochrome and color, in various color depths, and optionally with data compression, alpha channels, and color profiles. The Windows Metafile (WMF) specification covers the BMP file format. Among others, wingdi.h defines BMP constants and structures. | https://en.wikipedia.org/wiki/BMP_file_format |
| BASIC Stamp | The BASIC Stamp is a microcontroller with a small, specialized BASIC interpreter (PBASIC) built into ROM. It is made by Parallax, Inc. and has been popular with electronics hobbyists since the early 1990s. | https://en.wikipedia.org/wiki/BASIC_Stamp |
| Atmel AVR instruction set | The Atmel AVR instruction set is the machine language for the Atmel AVR, a modified Harvard architecture 8-bit RISC single chip microcontroller which was developed by Atmel in 1996. The AVR was one of the first microcontroller families to use on-chip flash memory for program storage. | https://en.wikipedia.org/wiki/Atmel_AVR_instruction_set |
| Atari Microsoft BASIC | The Atari Microsoft BASIC and Atari Microsoft BASIC II variants of the BASIC programming language were ROM cartridge or floppy disk packaged versions of the Microsoft BASIC dialect ported to the Atari 8-bit machines. Atari originally licensed Microsoft BASIC for use in their 8-bit computers, but were unable to fit it in an 8 KB ROM cartridge, the largest cartridge size available at the time. They outsourced to another company, Shepardson Microsystems Inc. (SMI), who had similar problems fitting the language onto an 8k cartridge. SMI proposed creating an entirely new version of BASIC for the new platforms, and built Atari BASIC instead. Atari Microsoft BASIC, unlike Atari BASIC, didn't allow abbreviations for keywords; keywords had to be fully spelled out. Syntax checking occurred after running a program, not immediately after entering the line. Also, arithmetic operations with integers resulted in an integer result. Atari Microsoft BASIC came in two packages: Floppy disk – CX8126 ROM cartridge – RX8035. Since the cartridge could only hold 16 KB, the remaining 11 KB file was included on an "extension" disk. The cartridge version was called Atari Microsoft BASIC II.Although more feature filled than Atari BASIC, Microsoft BASIC never had the popularity that Atari BASIC had. The biggest problems were: increased memory needed (at least 32 KB) disk drive required performance (faster than Atari BASIC, but slower than Turbo-Basic XL and BASIC XL) not compatible with Atari BASIC added costThe cartridge version eliminated the first two requirements, but a disk drive was needed for all of its features. | https://en.wikipedia.org/wiki/Atari_Microsoft_BASIC |
| Avionics Architecture Design Language | The Architecture Analysis & Design Language (AADL) is an architecture description language standardized by SAE. AADL was first developed in the field of avionics, and was known formerly as the Avionics Architecture Description Language.The Architecture Analysis & Design Language is derived from MetaH, an architecture description language made by the Advanced Technology Center of Honeywell. AADL is used to model the software and hardware architecture of an embedded, real-time system. Due to its emphasis on the embedded domain, AADL contains constructs for modeling both software and hardware components (with the hardware components named "execution platform" components within the standard). This architecture model can then be used either as a design documentation, for analyses (such as schedulability and flow control) or for code generation (of the software portion), like UML. | https://en.wikipedia.org/wiki/Architecture_Analysis_%26_Design_Language |
| AGC | The Apollo Guidance Computer (AGC) was a digital computer produced for the Apollo program that was installed on board each Apollo Command Module (CM) and Lunar Module (LM). The AGC provided computation and electronic interfaces for guidance, navigation, and control of the spacecraft. The AGC has a 16-bit word length, with 15 data bits and one parity bit. Most of the software on the AGC is stored in a special read-only memory known as core rope memory, fashioned by weaving wires through magnetic cores, though a small amount of read-write core memory is available. Astronauts communicated with the AGC using a numeric display and keyboard called the DSKY (DiSplay&KeYboard, pronounced 'DISS-key'). The AGC and its DSKY user interface were developed in the early 1960s for the Apollo program by the MIT Instrumentation Laboratory and first flew in 1966. The AGC was one of the first integrated circuit-based computers. The computer's performance was comparable to the first generation of home computers from the late 1970s, such as the Apple II, TRS-80, and Commodore PET. | https://en.wikipedia.org/wiki/Apollo_Guidance_Computer |
| Analytical engine | The Analytical Engine was a proposed mechanical general-purpose computer designed by English mathematician and computer pioneer Charles Babbage. It was first described in 1837 as the successor to Babbage's difference engine, a design for a mechanical computer. The Analytical Engine incorporated an arithmetic logic unit, control flow in the form of conditional branching and loops, and integrated memory, making it the first design for a general-purpose computer that could be described in modern terms as Turing-complete. In other words, the logical structure of the Analytical Engine was essentially the same as that which has dominated computer design in the electronic era.Babbage was never able to complete construction of any of his machines due to conflicts with his chief engineer and inadequate funding. It was not until the late 1940s that the first general-purpose computers were actually built, more than a century after Babbage had proposed the pioneering Analytical Engine in 1837. | https://en.wikipedia.org/wiki/Analytical_engine |
| Alternate Instruction Set | The Alternate Instruction Set (AIS) is a second 32-bit instruction set architecture found in some x86 CPUs made by VIA Technologies. On these VIA C3 processors, the second hidden processor mode is accessed by executing the x86 instruction ALTINST (0F 3F). If AIS mode has been enabled, the processor will perform a JMP EAX and begin executing AIS instructions at the address of the EAX register. Using AIS allows native access to the Centaur Technology-designed RISC core inside the processor. | https://en.wikipedia.org/wiki/Alternate_Instruction_Set |
| Alpha | The Alpha language was the original database language proposed by Edgar F. Codd, the inventor of the relational database approach. It was defined in Codd's 1971 paper "A Data Base Sublanguage Founded on the Relational Calculus". Alpha influenced the design of QUEL. It was eventually supplanted by SQL (which is however based on the relational algebra defined by Codd in "Relational Completeness of Data Base Sublanguages"), which IBM developed for its first commercial relational database product. | https://en.wikipedia.org/wiki/Alpha_%28programming_language%29 |
| Advanced Message Queuing Protocol | The Advanced Message Queuing Protocol (AMQP) is an open standard application layer protocol for message-oriented middleware. The defining features of AMQP are message orientation, queuing, routing (including point-to-point and publish-and-subscribe), reliability and security. AMQP mandates the behavior of the messaging provider and client to the extent that implementations from different vendors are interoperable, in the same way as SMTP, HTTP, FTP, etc. have created interoperable systems. Previous standardizations of middleware have happened at the API level (e.g. JMS) and were focused on standardizing programmer interaction with different middleware implementations, rather than on providing interoperability between multiple implementations. Unlike JMS, which defines an API and a set of behaviors that a messaging implementation must provide, AMQP is a wire-level protocol. A wire-level protocol is a description of the format of the data that is sent across the network as a stream of bytes. Consequently, any tool that can create and interpret messages that conform to this data format can interoperate with any other compliant tool irrespective of implementation language. | https://en.wikipedia.org/wiki/Advanced_Message_Queuing_Protocol |
| Advanced Continuous Simulation Language | The Advanced Continuous Simulation Language, or ACSL (pronounced "axle"), is a computer language designed for modeling and evaluating the performance of continuous systems described by time-dependent, nonlinear differential equations. Like SIMCOS and TUTSIM, ACSL is a dialect of the Continuous System Simulation Language (CSSL), originally designed by the Simulation Councils Inc (SCI) in 1967 in an attempt to unify the continuous simulations field. | https://en.wikipedia.org/wiki/Advanced_Continuous_Simulation_Language |
| Advanced Authoring Format | The Advanced Authoring Format (AAF) is a file format for professional cross-platform data interchange, designed for the video post-production and authoring environment. It was created by the Advanced Media Workflow Association (AMWA), and is now being standardized through the Society of Motion Picture and Television Engineers (SMPTE). | https://en.wikipedia.org/wiki/Advanced_Authoring_Format |
| Actor | The Actor programming language was invented by Charles Duff of The Whitewater Group in 1988. It was an offshoot of some object-oriented extensions to the Forth language he had been working on. Actor would be categorized as a pure object-oriented language in the style of Smalltalk. Like Smalltalk, everything was an object, including small integers. A Baker semi-space garbage collector was used, along with (in memory-constrained Windows 2.1 days) a software virtual memory system that swapped objects. A token threaded interpreter, written in 16-bit x86 assembly language, was the execution mechanism for compiled code. Actor only was released on the Microsoft Windows 2.1 and 3.0 operating system. Actor used perhaps the first pure object-oriented framework over native operating system calls as its basic GUI architecture. This allowed an Actor application to look and feel exactly like a Windows application written in C, but with all the advantages of an interactive Smalltalk-like development environment. Both a downside and upside to this architecture was a tight coupling to the Windows OS architecture, with a thin abstraction layer into objects. This allowed direct use of the rich Windows OS API, but also made it nearly impossible to support any other OS without a significant rewrite of the application framework. | https://en.wikipedia.org/wiki/Actor_(programming_language) |
| Acorn Atom | The Acorn Atom is a home computer made by Acorn Computers Ltd from 1980 to 1982, when it was replaced by the BBC Micro. The Micro began life as an upgrade to the Atom, originally known as the Proton. The Atom was a progression of the MOS Technology 6502-based machines that the company had been making from 1979. The Atom was a cut-down Acorn System 3 without a disk drive but with an integral keyboard and cassette tape interface, sold in either kit or complete form. In 1980 it was priced between £120 in kit form, £170 ready assembled, to over £200 for the fully expanded version with 12 KB of RAM and the floating point extension ROM. The minimum Atom had 2 KB of RAM and 8 KB of ROM, with the maximum specification machine having 12 KB of each. An additional floating point ROM was also available. The 12 KB of RAM was divided between 1 KB for the zero page, 5 KB available for programs, and 6 KB for the high resolution graphics. The zero page was used by the CPU for stack storage, by the OS, and by the Atom BASIC for storage of the 27 variables. If high resolution graphics were not required then 5½ KB of the upper memory could be used for program storage. It had an MC6847 Video Display Generator (VDG) video chip, allowing for both text and graphics modes. It could be connected to a TV or modified to output to a video monitor. Basic video memory was 1 KB but could be expanded to 6 KB. Since the MC6847 could only output at 60 Hz, meaning that the video could not be resolved on a large proportion of European TV sets, a 50 Hz PAL colour card was later made available. Six video modes were available, with resolutions from 64×64 in 4 colours, up to 256×192 in monochrome. At the time, 256×192 was considered to be high resolution. It had built-in BASIC (Atom BASIC), a fast but idiosyncratic version, which included indirection operators (similar to PEEK and POKE) for bytes and words (of 4 bytes each). Assembly code could be included within a BASIC program, because the BASIC interpreter also contained an assembler for the 6502 assembly language which assembled the inline code during program execution and then executed it. This was a very unusual, but also very useful, function. In late 1982, Acorn released an upgrade ROM chip for the Atom which allowed users to switch between Atom BASIC and the more advanced BASIC used by the BBC Micro. The upgrade was purely to the programming language; the Atom's graphics and sound capabilities remained unchanged, and hence, contrary to some pre-release beliefs, the BBC BASIC ROM did not allow Atom users to run commercial BBC Micro software, since nearly all of it took advantage of the BBC machine's much more advanced graphics and sound hardware. Commercial BBC Micro cassettes could not have been loaded anyway, as they ran at a transfer rate of 1200 baud and the Atom's cassette interface only supported 300 baud. The manual for the Atom was called Atomic Theory and Practice and was written by David Johnson-Davies, subsequently Managing Director of Acornsoft. (The manual used the jargon 'pling' for exclamation mark, a term which may have originated at Acorn, and of which this may have been the first published usage.) The Acorn LAN, Econet, was first configured on the Atom. The case was designed by industrial designer Allen Boothroyd of Cambridge Product Design Ltd. | https://en.wikipedia.org/wiki/Acorn_Atom |
| ABC 80 | The ABC 80 (Advanced BASIC Computer 80) was a personal computer engineered by the Swedish corporation Dataindustrier AB (DIAB) and manufactured by Luxor in Motala, Sweden in the late 1970s and early 1980s. It was introduced on the market in August 1978. The ABC 80 was based on an earlier modular computer system from the same company and built around a Z80 and 16 KB of ROM containing a fast semi-compiling BASIC interpreter. It had 16-32 KB of RAM as main memory and a dedicated (included) tape recorder for program and data storage, but could also be expanded to handle disk drives as well as many other peripherals. The ROM could be extended in increments of 1 or 4KB in order to handle such so called "options". The monitor was a black and white TV set modified for the purpose, an obvious choice since Luxor also made TVs. The ABC 80 was used in schools and officies around Scandinavia and parts of Europe. It was also used for industrial automation, scientific measurement and control systems. Like its successor, the ABC 800, the computer had an unusually quick and usable BASIC with excellent I/O response times, something that was often discovered when trying to switch to IBM PC-based personal computers. Due to its roots in an industrial computer system, the ABC 80 also had a flexible bus extension system with many (external) expansion and peripheral cards available for various purposes and applications, as well as high quality support and documentation. ABC 80 was also manufactured on license as BRG ABC80 by Budapesti Rádiótechnikai Gyár in Hungary. It used the same keyboard, but the case was metal instead of plastic. | https://en.wikipedia.org/wiki/ABC_80 |
| A-0 system | The A-0 system (Arithmetic Language version 0), written by Grace Murray Hopper in 1951 and 1952 for the UNIVAC I, was an early compiler related tool developed for electronic computers. The A-0 functioned more as a loader or linker than the modern notion of a compiler. A program was specified as a sequence of subroutines and arguments. The subroutines were identified by a numeric code and the arguments to the subroutines were written directly after each subroutine code. The A-0 system converted the specification into machine code that could be fed into the computer a second time to execute the said program. The A-0 system was followed by the A-1, A-2, A-3 (released as ARITH-MATIC), AT-3 (released as MATH-MATIC) and B-0 (released as FLOW-MATIC). The A-2 system was developed at the UNIVAC division of Remington Rand in 1953 and released to customers by the end of that year. Customers were provided the source code for A-2 and invited to send their improvements back to UNIVAC. Thus A-2 was an early example of free and open-source software. | https://en.wikipedia.org/wiki/A-0_System |
| Texy! | Texy is a lightweight markup language as well as converter of this format to XHTML, in a form of a library written in the PHP scripting language. It allows the user to write structured documents without knowledge or using of HTML language. Users write documents in human-readable text format and Texy converts it to structurally valid and well-formed XHTML code. Texy! format includes tags for turning off the formatter as well as for direct CSS styling, thus it can be said it fully supports HTML and CSS. The format itself supports images, links (anchors), nested lists, and tables, among other things. Other built-in features include a support of long words division (with respect for language rules), roll-over images, clickable emails and URL (emails are obfuscated against spambots), and an auto-correct tool for several typographic issues: national single and double quotation marks, ellipses, em dashes, dimension sign, nonbreakable spaces (e.g. in phone numbers), acronyms, arrows and many others. PHP implementation of Texy has been developed by David Grudl since 2004. It runs on PHP version 4.3.3 or newer and it can be used in any other platform using XML/RPC service. Current stable version is 2.9. Version 3.0 is planned. Texy! is distributed under the GNU General Public License and New BSD License. Plugins for several content-management systems are included. Java implementation, named JTexy, is under development. The project has its own website with basic description, syntax overview, on-line demo, XMLRPC, forum. Support for English-speaking users could be described as poor. | https://en.wikipedia.org/wiki/Texy! |
| Textile | Textile is a lightweight markup language that uses a text formatting syntax to convert plain text into structured HTML markup. Textile is used for writing articles, forum posts, readme documentation, and any other type of written content published online. | https://en.wikipedia.org/wiki/Textile_(markup_language) |
| TextMate | TextMate is a general-purpose GUI text editor for Mac OS X created by Allan Odgaard. TextMate features declarative customizations, tabs for open documents, recordable macros, folding sections, snippets, shell integration, and an extensible bundle system. | https://en.wikipedia.org/wiki/TextMate |
| Text Adventure Development System | Text Adventure Development System (TADS) is a prototype-based domain-specific programming language and set of standard libraries for creating interactive fiction (IF) games. | https://en.wikipedia.org/wiki/TADS |
| Turtle | Terse RDF Triple Language (Turtle) is a syntax and file format for expressing data in the Resource Description Framework (RDF) data model. Turtle syntax is similar to that of SPARQL, an RDF query language. RDF represents information using semantic triples, which comprise a subject, predicate, and object. Each item in the triple is expressed as a Web URI. Turtle provides a way to group three URIs to make a triple, and provides ways to abbreviate such information, for example by factoring out common portions of URIs. For example: |
https://en.wikipedia.org/wiki/Turtle_(syntax) |
| TensorFlow | TensorFlow is an open-source software library for dataflow programming across a range of tasks. It is a symbolic math library, and also used for machine learning applications such as neural networks. It is used for both research and production at Google, often replacing its closed-source predecessor, DistBelief. TensorFlow was developed by the Google Brain team for internal Google use. It was released under the Apache 2.0 open source license on November 9, 2015. | https://en.wikipedia.org/wiki/TensorFlow |
| Telnet | Telnet is a protocol used on the Internet or local area network to provide a bidirectional interactive text-oriented communication facility using a virtual terminal connection. User data is interspersed in-band with Telnet control information in an 8-bit byte oriented data connection over the Transmission Control Protocol (TCP). Telnet was developed in 1969 beginning with RFC 15, extended in RFC 855, and standardized as Internet Engineering Task Force (IETF) Internet Standard STD 8, one of the first Internet standards. The name stands for "teletype network".Historically, Telnet provided access to a command-line interface (usually, of an operating system) on a remote host, including most network equipment and operating systems with a configuration utility (including systems based on Windows NT). However, because of serious security concerns when using Telnet over an open network such as the Internet, its use for this purpose has waned significantly in favor of SSH. The term telnet is also used to refer to the software that implements the client part of the protocol. Telnet client applications are available for virtually all computer platforms. Telnet is also used as a verb. To telnet means to establish a connection using the Telnet protocol, either with command line client or with a programmatic interface. For example, a common directive might be: "To change your password, telnet into the server, log in and run the passwd command." Most often, a user will be telnetting to a Unix-like server system or a network device (such as a router) and obtaining a login prompt to a command line text interface or a character-based full-screen manager. | https://en.wikipedia.org/wiki/Telnet |
| Tefkat | Tefkat is a Model Transformation Language and a model transformation engine. The language is based on F-logic and the theory of stratified logic programs. The engine is an Eclipse plug-in for the Eclipse Modeling Framework (EMF). | https://en.wikipedia.org/wiki/Tefkat |
| Tea | Tea is a high level scripting language for the Java environment. It combines features of Scheme, Tcl, and Java. Integrated support for all major programming paradigms. Functional programming language. Functions are first class objects. Scheme-like closures are intrinsic to the language. Support for object oriented programming. Modular libraries with autoloading on demand facilities. Large base of core functions and classes. String and list processing. Regular expressions. File and network I/O. Database access. XML processing. 100% Pure Java. The Tea interpreter is implemented in Java. Tea runs anywhere with a Java 1.6 JVM or higher. Java reflection features allow the use of Java libraries directly from Tea code. Intended to be easily extended in Java. For example, Tea supports relational database access through JDBC, regular expressions through GNU Regexp, and an XML parser through a SAX parser (XML4J for example). | https://en.wikipedia.org/wiki/Tea_(programming_language) |
| Tex | TeX ( or , see below), stylized within the system as TeX, is a typesetting system (or "formatting system") designed and mostly written by Donald Knuth and released in 1978. Together with the Metafont language for font description and the Computer Modern family of typefaces, TeX was designed with two main goals in mind: to allow anybody to produce high-quality books using minimal effort, and to provide a system that would give exactly the same results on all computers, at any point in time. TeX is free software, which made it accessible to a wide range of users. TeX is a popular means by which to typeset complex mathematical formulae; it has been noted as one of the most sophisticated digital typographical systems. TeX is popular in academia, especially in mathematics, computer science, economics, engineering, physics, statistics, and quantitative psychology. It has largely displaced Unix troff, the other favored formatting system, in many Unix installations, which use both for different purposes. It is also used for many other typesetting tasks, especially in the form of LaTeX, ConTeXt, and other macro packages. | https://en.wikipedia.org/wiki/TeX |
| Tcl | Tcl (pronounced "tickle" or tee cee ell, ) is a high-level, general-purpose, interpreted, dynamic programming language. It was designed with the goal of being very simple but powerful. Tcl casts everything into the mold of a command, even programming constructs like variable assignment and procedure definition. Tcl supports multiple programming paradigms, including object-oriented, imperative and functional programming or procedural styles. It is commonly used embedded into C applications, for rapid prototyping, scripted applications, GUIs, and testing. Tcl interpreters are available for many operating systems, allowing Tcl code to run on a wide variety of systems. Because Tcl is a very compact language, it is used on embedded systems platforms, both in its full form and in several other small-footprint versions. The popular combination of Tcl with the Tk extension is referred to as Tcl/Tk, and enables building a graphical user interface (GUI) natively in Tcl. Tcl/Tk is included in the standard Python installation in the form of Tkinter. | https://en.wikipedia.org/wiki/Tcl |
| Tahoe-LAFS | Tahoe-LAFS (Tahoe Least-Authority File Store) is a free and open, secure, decentralized, fault-tolerant, distributed data store and distributed file system. It can be used as an online backup system, or to serve as a file or Web host similar to Freenet, depending on the front-end used to insert and access files in the Tahoe system. Tahoe can also be used in a RAID-like fashion using multiple disks to make a single large Redundant Array of Inexpensive Nodes (RAIN) pool of reliable data storage. The system is designed and implemented around the "principle of least authority" (POLA). Strict adherence to this convention is enabled by the use of cryptographic capabilities that provide the minimum set of privileges necessary to perform a given task by asking agents. A RAIN array acts as a storage volume; these servers do not need to be trusted by confidentiality or integrity of the stored data. | https://en.wikipedia.org/wiki/Tahoe-LAFS |
| Tagged Image File Format | Tagged Image File Format, abbreviated TIFF or TIF, is a computer file format for storing raster graphics images, popular among graphic artists, the publishing industry, and photographers. TIFF is widely supported by scanning, faxing, word processing, optical character recognition, image manipulation, desktop publishing, and page-layout applications. The format was created by Aldus Corporation for use in desktop publishing. It published the latest version 6.0 in 1992, subsequently updated with an Adobe Systems copyright after the latter acquired Aldus in 1994. Several Aldus or Adobe technical notes have been published with minor extensions to the format, and several specifications have been based on TIFF 6.0, including TIFF/EP (ISO 12234-2), TIFF/IT (ISO 12639), TIFF-F (RFC 2306) and TIFF-FX (RFC 3949). | https://en.wikipedia.org/wiki/TIFF |
| Tableau Software | Tableau Software ( tab-LOH) is an interactive data visualization software company founded on January 2003 by Christian Chabot, Pat Hanrahan and Chris Stolte, in Mountain View, California. The company is currently headquartered in Seattle, Washington, United States focused on business intelligence. On June 10, 2019, Salesforce.com announced it would be acquiring Tableau.Chabot, Hanrahan and Stolte were researchers at the Department of Computer Science at Stanford University who specialized in visualization techniques for exploring and analyzing relational databases and data cubes. The company was started as a commercial outlet for research produced at Stanford between 1999-2002. Tableau products query relational databases, online analytical processing cubes, cloud databases, and spreadsheets to generate graph-type data visualizations. The products can also extract, store, and retrieve data from an in-memory data engine. | https://en.wikipedia.org/wiki/Tableau_Software |
| TXL | TXL is a special-purpose programming language originally designed by Charles Halpern-Hamu and James Cordy at the University of Toronto in 1985. The acronym "TXL" originally stood for "Turing eXtender Language" after the language's original purpose, the specification and rapid prototyping of variants and extensions of the Turing programming language, but no longer has any meaningful interpretation. Modern TXL is specifically designed for creating, manipulating and rapidly prototyping language-based descriptions, tools and applications using source transformation. It is a hybrid functional / rule-based language using first order functional programming at the higher level and term rewriting at the lower level. The formal semantics and implementation of TXL are based on formal term rewriting, but the term structures are largely hidden from the user due to the example-like style of pattern specification. Each TXL program has two components: a description of the source structures to be transformed, specified as a (possibly ambiguous) context-free grammar using an extended Backus–Naur Form; and a set of tree transformation rules, specified using pattern / replacement pairs combined using first order functional programming. TXL is designed to allow explicit programmer control over the interpretation, application, order and backtracking of both parsing and rewriting rules, allowing for expression of a wide range of grammar-based techniques such as agile parsing. The first component parses the input expression into a tree using pattern-matching. The second component uses Term-rewriting in a manner similar to Yacc to produce the transformed output. TXL is most commonly used in software analysis and reengineering tasks such as design recovery, and in rapid prototyping of new programming languages and dialects. | https://en.wikipedia.org/wiki/TXL_(programming_language) |
| TUTOR | TUTOR (also known as PLATO Author Language) is a programming language developed for use on the PLATO system at the University of Illinois at Urbana-Champaign around 1965. TUTOR was initially designed by Paul Tenczar for use in computer assisted instruction (CAI) and computer managed instruction (CMI) (in computer programs called "lessons") and has many features for that purpose. For example, TUTOR has powerful answer-parsing and answer-judging commands, graphics, and features to simplify handling student records and statistics by instructors. TUTOR's flexibility, in combination with PLATO's computational power (running on what was considered a supercomputer in 1972), also made it suitable for the creation of many non-educational lessons—that is, games—including flight simulators, war games, dungeon style multiplayer role-playing games, card games, word games, and medical lesson games such as Bugs and Drugs (BND). | https://en.wikipedia.org/wiki/TUTOR_(programming_language) |
| TTM | TTM is a string oriented, general purpose macro processing programming language developed in 1968 by Steven Caine and E. Kent Gordon at the California Institute of Technology. | https://en.wikipedia.org/wiki/TTM_(programming_language) |
| Tree and Tabular Combined Notation | TTCN is a programming language used for testing of communication protocols and web services. A TTCN test suite consists of many test cases written in the TTCN programming language. Until version 2 the language was written in tables and called Tree and Tabular Combined Notation. Reading and editing this language required special TTCN editors. Beginning with version 3 TTCN was renamed to Testing and Test Control Notation. It is now closer to current programming languages and can be edited with traditional editors. TTCN-3 is more flexible than TTCN-2 in that it can be used for protocol testing as well as testing traditional software. All versions of TTCN need dedicated compilers or interpreters for execution. TTCN is widely used, for example; ETSI, ITU for the testing of telecommunication protocols. Conformance test cases of ETSI standards like ISDN, DECT, GSM, EDGE, 3G, DSRC have also been written in TTCN. Recently it has also been used for testing various protocol standards e.g. Bluetooth, IP. Execution of those test cases against products (e.g. phones, mobile phones, service enablers or network elements) is used to verify that the protocol implementation in those products meet the requirements defined by telecommunication standards. TTCN is often combined with ASN.1. | https://en.wikipedia.org/wiki/TTCN |
| TScript | TScript is an object-oriented embeddable scripting language for C++ that supports hierarchical transient typed variables (TVariable). Its main design criterion is to create a scripting language that can interface with C++, transforming data and returning the result. This enables C++ applications to change their functionality after installation. | https://en.wikipedia.org/wiki/TScript |
| TRAC | TRAC (for Text Reckoning And Compiling) Language is a programming language developed between 1959-1964 by Calvin Mooers and implemented on a PDP-10 in 1964 by L. Peter Deutsch. It was one of three "first languages" recommended by Ted Nelson in Computer Lib. TRAC T64 was used until 1984, when Mooers updated it to TRAC T84. TRAC is a purely text-based language—a kind of macro language. Unlike traditional ad hoc macro languages of the time, such as those found in assemblers, TRAC is well planned, consistent, and in many senses complete. It has explicit input and output operators, unlike the typical implicit I/O at the outermost macro level, which makes it simultaneously simpler and more versatile than older macro languages. It also differs from traditional macro languages in that TRAC numbers are strings of digits, with integer arithmetic (without specific limits on maximum values) being provided through built-in ("primitive") functions. Arguably, one aspect of its completeness is that the concept of error is limited to events like lack of file space and requesting expansion of a string longer than the interpreter's working storage; what would in many languages be described as illegal operations are dealt with in TRAC by defining a result (often a null string) for every possible combination of a function's argument strings. The emphasis on strings as strings is so strong that TRAC provides mechanisms for handling the language's own syntactic characters either in their syntactic roles or like any other character, and self-modifying code has more the feel of a natural consequence of typical TRAC programming techniques than of being a special feature. TRAC is, like APL or LISP, an expression oriented language (in contrast to more typical procedure-oriented languages), but unlike APL, it completely lacks operators. In most respects, it is a case of pure functional programming. TRAC has in common with LISP a syntax that generally involves the presence of many levels of nested parentheses. Mooers trademarked the name TRAC in an effort to maintain his control over the definition of the language, an unusual and pioneering action at the time. At one point, he brought an intellectual property infringement suit against DEC, alleging that a contract to deliver a mini-computer with a TRAC interpreter violated his rights. "The first issue of Dr. Dobb's Journal, one of the early publications in the personal computer field, has a vitriolic editorial against Mooers and his rapacity in trying to charge people for his computing language." However, the trademark (#72301892) expired in 1992. The name has since been used several times for unrelated information technology projects, including a current open source project management system called Trac. There have been various languages inspired by TRAC. To avoid any trouble with Mooers, they renamed primitives and/or used different metacharacters. In SAM76's case, primitives were added, according to Claude Kagan, "because TRAC is baby talk". In MINT's case, primitives were added to give access to a sophisticated text editor machinery. one perceived shortcoming of TRAC was lack of full extensibility: some TRAC primitive functions are sensitive to the distinction between a null (zero-character) argument and a nonexistent (non-delimited) one, but beyond its last non-null argument, a user-defined function cannot make the distinction. SAM76 was a TRAC-like language which eliminated that limitation. Russ Nelson implemented an emacs extension language named MINT (MINT Is Not TRAC). This language is used by the FreeDOS editor FreeMACS. TRAC was used by FTP Software in its PC/TCP product as the modem dialler scripting language. TRAC was also used as a front end on Digital Productions Cray renderer for films, including The Last Starfighter. | https://en.wikipedia.org/wiki/TRAC_(programming_language) |
| TOM object-oriented | TOM was an object-oriented programming language developed in the 1990s that built on the lessons learned from Objective-C. The main purpose of TOM was to allow for "unplanned reuse" of code via a well-developed extension mechanism. This concept was introduced seemingly by accident in Objective-C and later proved to be of wide use, and was applied aggressively in TOM. The primary changes in TOM are the addition of multiple inheritance, tuples as a first-class part of the language, cleaner syntax, free of the C requirements for header files and pre-compiler commands, and the ability to use categories (the re-use mechanism) to include anything. It is this latter ability that represents "the whole idea". Unlike Objective-C's categories that allowed only new methods to be built onto existing classes, TOM allowed the addition of class and instance variables, new methods, even new superclasses. This results in the redefinition of "class" as "a class is defined by its main definition and any extensions", these extensions have become a first-class citizen of the language (similarly to Ruby). The book The Pragmatic Programmer lists TOM as an example for a new language to learn. Development of the TOM language has ceased. | https://en.wikipedia.org/wiki/TOM_(object-oriented_programming_language) |
| TMG | TMG (TransMoGrifier) is a compiler-compiler created by Robert M. McClure and presented in 1968, and implemented by Douglas McIlroy. TMG ran on systems like OS360 and early Unix. It was used to build EPL, an early version of PL/I. Ken Thompson used TMG in 1970 on PDP-7 as a tool to offer Fortran, but ended up creating the B programming language which was much influenced by BCPL. | https://en.wikipedia.org/wiki/TMG_(language) |
| TLA | TLA+ (pronounced as tee ell a plus, ) is a formal specification language developed by Leslie Lamport. It is used to design, model, document, and verify concurrent systems. TLA+ has been described as exhaustively-testable pseudocode, and its use likened to drawing blueprints for software systems; TLA is an acronym for Temporal Logic of Actions. For design and documentation, TLA+ fulfills the same purpose as informal technical specifications. However, TLA+ specifications are written in a formal language of logic and mathematics, and the precision of specifications written in this language is intended to uncover design flaws before system implementation is underway.Since TLA+ specifications are written in a formal language, they are amenable to finite model checking. The model checker finds all possible system behaviours up to some number of execution steps, and examines them for violations of desired invariance properties such as safety and liveness. TLA+ specifications use basic set theory to define safety (bad things won't happen) and temporal logic to define liveness (good things eventually happen). TLA+ is also used to write machine-checked proofs of correctness both for algorithms and mathematical theorems. The proofs are written in a declarative, hierarchical style independent of any single theorem prover backend. Both formal and informal structured mathematical proofs can be written in TLA+; the language is similar to LaTeX, and tools exist to translate TLA+ specifications to LaTeX documents.TLA+ was introduced in 1999, following several decades of research into a verification method for concurrent systems. A toolchain has since developed, including an IDE and distributed model checker. The pseudocode-like language PlusCal was created in 2009; it transpiles to TLA+ and is useful for specifying sequential algorithms. TLA+2 was announced in 2014, expanding language support for proof constructs. The current TLA+ reference is The TLA+ Hyperbook by Leslie Lamport. | https://en.wikipedia.org/wiki/TLA+ |
| TI-BASIC | TI-BASIC is the official name of a BASIC-like language built into Texas Instruments (TI)'s graphing calculators, including the TI-83 series, TI-84 Plus series, TI-89 series, TI-92 series (including Voyage 200), TI-73, and TI-Nspire. TI rarely refers to the language by name, but the name TI-BASIC has been used in some developer documentation. For many applications, it is the most convenient way to program any TI calculator, since the capability to write programs in TI-BASIC is built-in. Assembly language (often referred to as "asm") can also be used, and C compilers exist for translation into assembly: TIGCC for Motorola 68000 (68k) based calculators, and SDCC for Zilog Z80 based calculators. However, both of them are cross-compilers, not allowing on-calculator programming. TI-BASIC is considerably slower than the assembly language (because it has to be interpreted), making it better suited to writing programs to quickly solve math problems or perform repetitive tasks, rather than programming games or graphics-intensive applications. Some math instruction books even provide programs in TI-BASIC (usually for the widespread variant used by the TI-82/83/84 series). Although it is somewhat minimalist compared to programming languages used on computers, TI-BASIC is nonetheless an important factor in the programming community. Because TI graphing calculators are required for advanced mathematics classes in many high schools and universities, TI-BASIC often provides the first glimpse many students have into the world of programming. | https://en.wikipedia.org/wiki/TI-BASIC |
| THINK C | THINK C was an extension of ANSI C for the classic Mac OS developed by THINK Technologies; although named Lightspeed C in the original mid-1986 release, it was later renamed THINK C. THINK Technologies was later acquired by Symantec Corporation and the product continued to be developed by the original author, Michael Kahl. Version 3 and subsequent versions were essentially a subset of C++ and supported basic object oriented programming concepts such as single inheritance as well as extensions to the C standard that conformed more closely to the requirements of Mac OS programming. After version 6, the OOP facilities were expanded to a full C++ implementation, and the product was rebranded Symantec C++ for versions 7 and 8, now under development by different authors. THINK C (and later, Symantec C++) featured a class library and framework for Mac programming called the Think Class Library (TCL), which was used extensively for Macintosh application development. The Lightspeed/THINK C IDE was quite influential, though considered not as advanced as that belonging to THINK Pascal, its sister language product; it was considered the standard environment when MPW was considered an overpriced niche product, and most Macintosh products were developed in it for many years. With the transition of the Mac from 68K to PowerPC, however, Symantec was widely seen as having dropped the ball, and competitor Metrowerks's product CodeWarrior took control of the marketplace. Despite the decline in popularity of their IDE, Symantec was eventually chosen by Apple to provide next-generation C/C++ compilers for MPW in the form of Sc/Scpp for 68K alongside MrC/MrCpp for PowerPC. These remained Apple's standard compilers until the arrival of Mac OS X replaced them with GCC. Symantec subsequently exited the developer tool business. | https://en.wikipedia.org/wiki/THINK_C |
| THEOS | THEOS, which translates from Greek as "God", is an operating system which started out as OASIS, a microcomputer operating system for small computers that use the Z80 processor. Originally written in the late 1970s by Timothy S. Williams as a low-cost alternative to the more expensive mini- and mainframe- computers that were popular in the day, OASIS provided time-sharing multiuser facilities to allow several users to utilise the resources of one computer. Similar in concept to MP/M or UNIX, THEOS uses external device drivers rather than a kernel, allowing it to be more portable to other environments, though support has been primarily directed towards industry-standard hardware (i.e. PC's). THEOS is specifically aimed at small business users, with a wide range of vertical-market applications packages being developed and supported by individuals and companies. THEOS operating systems have been distributed by THEOS Software Corporation in Walnut Creek, California, since 1983. As of 2003, Phase One Systems publishes software development tools for THEOS(R) systems. As well as porting tools, Phase One Systems distributed the Freedom query package and Control database package for THEOS systems, used to bring SQL-like data extraction tools to third-party software packages. The languages distributed with THEOS include THEOS Multi-User Basic and C. A powerful EXEC shell language can be used for task automation or to produce a turnkey system. When the operating system was launched for the IBM Personal Computer/AT in 1982, the decision was taken to change the name from OASIS to THEOS, short for THE Operating System. A number of security features exist, including dynamic passwords (where the password includes part of the date or time, or client IP address, or other dynamic elements), allow/deny security, a comprehensive inbound and outbound firewall, and an option to require a certain level of encryption in the workstation connection. In addition, the object file format is proprietary, and the operating system uses Intel "protected mode" to further increase defence against buffer overrun attacks. THEOS was introduced in Europe by Fujitsu and other hardware manufacturers 30 years ago, and is distributed by a number of distributors in Great Britain, Spain, Portugal, Germany, Italy and more. The 'current' version is THEOS Corona Commercial Release 6, which was released in December 2008, and a number of updates have been released since that time. The current Windows Workstation Client (as of May 2009) is version 3.16 from July 2003. | https://en.wikipedia.org/wiki/THEOS |
| CA-Telon | TELON, later renamed CA-TELON, is one of the first commercially successful application generators for building business applications. | https://en.wikipedia.org/wiki/CA-Telon |
| TELCOMP | TELCOMP was a programming language developed at Bolt, Beranek and Newman (BBN) in about 1964 and in use until at least 1974. BBN offered TELCOMP as a paid service, with first revenue in October 1965. The service was sold to a company called On-Line Systems in 1972. In the United Kingdom, TELCOMP was offered by Time Sharing, Ltd, a partnership between BBN and an entrepreneur named Richard Evans. It was an interactive, conversational language based on JOSS, developed by BBN after Cliff Shaw from RAND visited the labs in 1964 as part of the NIH survey. It was first implemented on the PDP-1 and was used to provide a commercial time sharing service by BBN in the Boston area and later by Time Sharing Ltd. in the United Kingdom. In 1996, Leo Beranek said "We even developed a programming language called TELCOMP that to this day, some say was better than the programming language that the industry adopted, namely BASIC."There were at least three versions: TELCOMP I, TELCOMP II, and TELCOMP III. TELCOMP I was implemented on the PDP-1, TELCOMP II on the PDP-7 and TELCOMP III on the PDP-10, running on DEC 's TOPS-10 operating system or on BBN's own TENEX operating system. TELCOMP programs were normally input via a paper tape reader on a Teletype Model 33, which would be connected to a PDP via a modem and acoustic telephone line. Data could be read from the paper tape reader or from the Teletype keyboard. Output was either printed to the Teletype or sent to the paper tape punch. Early versions had no facility for on-line storage of programs or data. During data input using a Teletype, the user would type a response to a printed prompt. If, instead of hitting Return, the user hit Tab, another, possibly computed, prompt would be printed on the same line. This process could be repeated for the full width of the line. This unusual feature allowed very compact data entry, comparable to full-screen CRT data entry. It saved paper, and the input section of the form became part of the program's printed output. A later derivative of TELCOMP called STRINGCOMP was oriented towards string handling. Another BBN JOSS-derivative called FILECOMP was developed for the GE MEDINET system, which was cancelled. The implicit file handling system it contained was influential on the MUMPS global database system. The initial research for LOGO was carried out in TELCOMP, but only the JOSS-style errors and interaction made it through to the actual language. | https://en.wikipedia.org/wiki/TELCOMP |
| TECO | TECO (; originally an acronym for [paper] Tape editor and corrector, but later Text editor and corrector, then Text editor character oriented) is a text editor originally developed at the Massachusetts Institute of Technology (MIT) in the 1960s, after which it was modified by many other people. TECO was a direct ancestor of Emacs, which was originally implemented in TECO macros. | https://en.wikipedia.org/wiki/TECO_(text_editor) |
| TASM | TASM may refer to: Turbo Assembler, Borland's x86 assembler Turbo Assembler, Omikron's Commodore 64-based 6502 assembler Table Assembler, a table driven cross-assembler for small microprocessors Tomahawk Anti-Ship Missile Tulsa Air and Space Museum & Planetarium The Amazing Spider-Man | https://en.wikipedia.org/wiki/Tasm |
| TACPOL | TACPOL (Tactical Procedure Oriented Language) is a block structured programming language developed by the United States Army for the TACFIRE Tactical Fire Direction command and control application. TACPOL is similar to PL/I. | https://en.wikipedia.org/wiki/TACPOL_%28programming_language%29 |
| Tandem Advanced Command Language | TACL (the Tandem Advanced Command Language) is the scripting programming language used in Tandem Computers. TACL is the shell. | https://en.wikipedia.org/wiki/TACL |
| SystemVerilog | SystemVerilog, standardized as IEEE 1800, is a hardware description and hardware verification language used to model, design, simulate, test and implement electronic systems. SystemVerilog is based on Verilog and some extensions, and since 2008 Verilog is now part of the same IEEE standard. It is commonly used in the semiconductor and electronic design industry as an evolution of Verilog. | https://en.wikipedia.org/wiki/SystemVerilog |
| Synon | Synon was a software company which, at its height, dominated the worldwide market for third-party application development tools for the IBM System i (formerly AS/400) platform. Its products continue to be widely used in that sector today, distributed and supported by CA Inc.. Synon pioneered what is now sometimes called Architected Rapid Application Development (ARAD). | https://en.wikipedia.org/wiki/Synon |
| SIMPL | Synchronous Interprocess Messaging Project for LINUX (SIMPL) is a free and open-source project that allows QNX-style synchronous message passing by adding a Linux library using user space techniques like shared memory and Unix pipes to implement SendMssg/ReceiveMssg/ReplyMssg inter-process messaging mechanisms. | https://en.wikipedia.org/wiki/SIMPL |
| SMIL | Synchronized Multimedia Integration Language (SMIL ()) is a World Wide Web Consortium recommended Extensible Markup Language (XML) markup language to describe multimedia presentations. It defines markup for timing, layout, animations, visual transitions, and media embedding, among other things. SMIL allows presenting media items such as text, images, video, audio, links to other SMIL presentations, and files from multiple web servers. SMIL markup is written in XML, and has similarities to HTML. | https://en.wikipedia.org/wiki/Synchronized_Multimedia_Integration_Language |
| SYNAPSE | SyNAPSE is a DARPA program that aims to develop electronic neuromorphic machine technology, an attempt to build a new kind of cognitive computer with form, function, and architecture similar to the mammalian brain. Such artificial brains would be used in robots whose intelligence would scale with the size of the neural system in terms of total number of neurons and synapses and their connectivity. SyNAPSE is a backronym standing for Systems of Neuromorphic Adaptive Plastic Scalable Electronics. The name alludes to synapses, the junctions between biological neurons. The program is being undertaken by HRL Laboratories (HRL), Hewlett-Packard, and IBM Research. In November 2008, IBM and its collaborators were awarded $4.9 million in funding from DARPA while HRL and its collaborators were awarded $5.9 million in funding from DARPA. For the next phase of the project, DARPA added $16.1 million more to the IBM effort while HRL received an additional $10.7 million. In 2011, DARPA added $21 million more to the IBM project. and an additional $17.9 million to the HRL project. The SyNAPSE team for IBM is led by Dharmendra Modha, manager of IBM's cognitive computing initiative. The SyNAPSE team for HRL is led by Narayan Srinivasa, manager of HRL's Center for Neural and Emergent Systems.The initial phase of the SyNAPSE program developed nanometer scale electronic synaptic components capable of adapting the connection strength between two neurons in a manner analogous to that seen in biological systems (Hebbian learning), and simulated the utility of these synaptic components in core microcircuits that support the overall system architecture. Continuing efforts will focus on hardware development through the stages of microcircuit development, fabrication process development, single chip system development, and multi-chip system development. In support of these hardware developments, the program seeks to develop increasingly capable architecture and design tools, very large-scale computer simulations of the neuromorphic electronic systems to inform the designers and validate the hardware prior to fabrication, and virtual environments for training and testing the simulated and hardware neuromorphic systems. | https://en.wikipedia.org/wiki/SyNAPSE |
| Swift | Swift is a general-purpose, multi-paradigm, compiled programming language developed by Apple Inc. for iOS, macOS, watchOS, tvOS, and Linux. Swift is designed to work with Apple's Cocoa and Cocoa Touch frameworks and the large body of existing Objective-C (ObjC) code written for Apple products. It is built with the open source LLVM compiler framework and has been included in Xcode since version 6. On platforms other than Linux, it uses the Objective-C runtime library which allows C, Objective-C, C++ and Swift code to run within one program. Apple intended Swift to support many core concepts associated with Objective-C, notably dynamic dispatch, widespread late binding, extensible programming and similar features, but "safer" (easier to catch software bugs); Swift has features addressing some common programming errors like null pointers and provides syntactic sugar to help avoid the pyramid of doom. Swift supports the concept of protocol extensibility, an extensibility system that can be applied to types, structs and classes, which Apple promotes as a real change in programming paradigms they term "protocol-oriented programming" (similar to traits). Swift was introduced at Apple's 2014 Worldwide Developers Conference (WWDC). It underwent an upgrade to version 1.2 during 2014 and a more major upgrade to Swift 2 at WWDC 2015. Initially a proprietary language, version 2.2 was made open-source software under the Apache License 2.0 on December 3, 2015, for Apple's platforms and Linux. In March 2017, Swift made the top 10 in the monthly TIOBE index ranking of popular programming languages, while since then it slipped down the list to 20. | https://en.wikipedia.org/wiki/Swift_(programming_language) |
| Sweave | Sweave is a function in the statistical programming language R that enables integration of R code into LaTeX or LyX documents. The purpose is "to create dynamic reports, which can be updated automatically if data or analysis change".The data analysis is performed at the moment of writing the report, or more exactly, at the moment of compiling the Sweave code with Sweave (i.e., essentially with R) and subsequently with LaTeX. This can facilitate the creation of up-to-date reports for the author. Because the Sweave files together with any external R files that might be sourced from them and the data files contain all the information necessary to trace back all steps of the data analyses, Sweave also has the potential to make research more transparent and reproducible to others. However, this is only the case to the extent that the author makes the data and the R and Sweave code available. If the author only publishes the resulting PDF document or printed versions thereof, a report created using Sweave is no more transparent or reproducible than the same report created with other statistical and text preparation software. | https://en.wikipedia.org/wiki/Sweave |
| Swagger | Swagger is an open source software framework backed by a large ecosystem of tools that helps developers design, build, document, and consume RESTful Web services. While most users identify Swagger by the Swagger UI tool, the Swagger toolset includes support for automated documentation, code generation, and test case generation. Sponsored by SmartBear Software, Swagger has been a strong supporter of Open Source Software and has widespread adoption. | https://en.wikipedia.org/wiki/Swagger_(software) |
| SuperTalk | SuperTalk is the scripting language used in SuperCard. SuperTalk is a descendant of HyperTalk. | https://en.wikipedia.org/wiki/SuperTalk |
| SuperCollider | SuperCollider is an environment and programming language originally released in 1996 by James McCartney for real-time audio synthesis and algorithmic composition. Since then it has been evolving into a system used and further developed by both scientists and artists working with sound. It is an efficient and expressive dynamic programming language providing a framework for acoustic research, algorithmic music, interactive programming and live coding. Released under the terms of the GPLv2 in 2002, SuperCollider is free and open-source software. | https://en.wikipedia.org/wiki/SuperCollider |
| SuperBASIC | SuperBASIC is an advanced variant of the BASIC programming language with many structured programming additions. It was developed at Sinclair Research by Jan Jones during the early 1980s. Originally SuperBASIC was intended for a home computer, code-named SuperSpectrum, then under development. This project was later cancelled; however, SuperBASIC was subsequently included in the ROM firmware of the Sinclair QL microcomputer (announced in January 1984), also serving as the command line interpreter for the QL's Qdos operating system. It is notable for being the first second-generation BASIC to be integrated into a microcomputer's operating system, so making the latter user-extendable—as exemplified by Linus Torvalds in his formative years. | https://en.wikipedia.org/wiki/SuperBASIC |
| Sun Raster | Sun Raster was a raster graphics file format used on SunOS by Sun Microsystems. The format has no MIME type, it is specified in @(#)rasterfile.h 1.11 89/08/21 SMI. The format was used for some research papers.ACDSee, FFmpeg, GIMP, ImageMagick, IrfanView, LibreOffice, Netpbm, PaintShop Pro, and XnView among others support Sun Raster image files. In version 2.13 XnView supported the file extensions .ras and .sun for this graphics file format. In version 2.1.4 FFmpeg could encode and decode Sun Raster pixel formats bgr24, pal8, gray, and monow. The format does not support transparency. The plain text Sun icon format specified in @(#)icon_load.h 10.5 89/09/05 SMI is unrelated to the Sun Raster format. | https://en.wikipedia.org/wiki/Sun_Raster |
| Subtext | Subtext is a moderately visual programming language and environment, for writing application software. It is an experimental, research attempt to develop a new programming model, called Example Centric Programming, by treating copied blocks as first class prototypes, for program structure. It uses live text, similar to what occurs in spreadsheets as users update cells, for frequent feedback. It is intended to eventually be developed enough to become a practical language for daily use. It is planned to be open software; the license is not yet determined. Subtext was created by Jonathan Edwards who submitted a paper on the language to OOPSLA. It was accepted as part of the 2005 conference. | https://en.wikipedia.org/wiki/Subtext_(programming_language) |
| Sublime Text | Sublime Text is a proprietary cross-platform source code editor with a Python application programming interface (API). It natively supports many programming languages and markup languages, and functions can be added by users with plugins, typically community-built and maintained under free-software licenses. | https://en.wikipedia.org/wiki/Sublime_Text |
| Stylus | Stylus is a dynamic stylesheet language that is compiled into Cascading Style Sheets (CSS). Its design is influenced by Sass and LESS. It's regarded as the fourth most used CSS preprocessor syntax. It was created by TJ Holowaychuk, a former programmer for Node.js and the creator of the Luna language. It is written in JADE and Node.js. | https://en.wikipedia.org/wiki/Stylus_(stylesheet_language) |
| Structured text | Structured text, abbreviated as ST or STX, is one of the five languages supported by the IEC 61131-3 standard, designed for programmable logic controllers (PLCs). It is a high level language that is block structured and syntactically resembles Pascal, on which it is based. All of the languages share IEC61131 Common Elements. The variables and function calls are defined by the common elements so different languages within the IEC 61131-3 standard can be used in the same program. Complex statements and nested instructions are supported: Iteration loops (REPEAT-UNTIL; WHILE-DO) Conditional execution (IF-THEN-ELSE; CASE) Functions (SQRT(), SIN()) | https://en.wikipedia.org/wiki/Structured_text |
| Structured Product Labeling | Structured Product Labeling (SPL) is a Health Level Seven International (HL7) standard which defines the content of human prescription drug labeling in an XML format. The "drug label" includes all published material accompanying a drug, such as the actual label on a prescribed dose as well as the package insert which contains a great deal of detailed information about the drug. As of Release 4 of the SPL standard, 22,000 FDA informational product inserts have been encoded according to the standard.SPL documents contain both the content of labeling (all text, tables and figures) for a product along with additional machine readable information (drug listing data elements). Drug listing data elements include information about the product (product and generic names, ingredients, ingredient strengths, dosage forms, routes of administration, appearance, DEA schedule) and the packaging (package quantity and type). | https://en.wikipedia.org/wiki/Structured_Product_Labeling |
| SAOL | Structured Audio Orchestra Language (SAOL) is an imperative, MUSIC-N programming language designed for describing virtual instruments, processing digital audio, and applying sound effects. It was published as subpart 5 of MPEG-4 Part 3 (ISO/IEC 14496-3:1999) in 1999.As part of the MPEG-4 international standard, SAOL is one of the key components of the MPEG-4 Structured Audio toolset, along with: Structured Audio Score Language (SASL) Structured Audio Sample Bank Format (SASBF) The MPEG-4 SA scheduler MIDI support | https://en.wikipedia.org/wiki/Structured_Audio_Orchestra_Language |
| Strongtalk | Strongtalk is a Smalltalk environment with optional static typing support. Strongtalk can make some compile time checks, and offer "stronger" type safety guarantees; this is the source of its name. It is non-commercial, though it was originally a commercial project developed by a small start-up company called LongView Technologies (trading as Animorphic Systems). | https://en.wikipedia.org/wiki/Strongtalk |
| Stripe company | Stripe is a US technology company operating in over 25 countries that allows both private individuals and businesses to accept payments over the Internet. Stripe focuses on providing the technical, fraud prevention, and banking infrastructure required to operate on-line payment systems. | https://en.wikipedia.org/wiki/Stripe_(company) |
| Stratego/XT | Stratego/XT is a language and toolset for constructing stand-alone program transformation systems. It combines the Stratego transformation language with the XT toolset of transformation components, providing a framework for constructing stand-alone program transformation systems. The Stratego language is based on a programming paradigm called strategic term rewriting. It provides rewrite rules for expressing basic transformation steps. The application of these rules can be controlled using strategies, a form of subroutines. The XT toolset provides reusable transformation components and declarative languages for deriving new components, such as parsing grammars using the Modular Syntax Definition Formalism (SDF) and implementing pretty-printing. | https://en.wikipedia.org/wiki/Stratego/XT |
| Strand | Strand is a high-level symbolic language for parallel computing, similar in syntax to Prolog. Artificial Intelligence Ltd were awarded the British Computer Society Award for Technical Innovation 1989 for Strand88. The language was created by computer scientists Ian Foster and Stephen Taylor. | https://en.wikipedia.org/wiki/Strand_%28programming_language%29 |
| Stockholm format | Stockholm format is a multiple sequence alignment format used by Pfam and Rfam to disseminate protein and RNA sequence alignments. The alignment editors Ralee and Belvu support Stockholm format as do the probabilistic database search tools, Infernal and HMMER, and the phylogenetic analysis tool Xrate. A simple example of an Rfam alignment (UPSK RNA) with a pseudoknot in Stockholm format is shown below: # STOCKHOLM 1.0 #=GF ID UPSK #=GF SE Predicted; Infernal #=GF SS Published; PMID 9223489 #=GF RN [1] #=GF RM 9223489 #=GF RT The role of the pseudoknot at the 3' end of turnip yellow mosaic #=GF RT virus RNA in minus-strand synthesis by the viral RNA-dependent RNA #=GF RT polymerase. #=GF RA Deiman BA, Kortlever RM, Pleij CW; #=GF RL J Virol 1997;71:5990-5996. AF035635.1/619-641 UGAGUUCUCGAUCUCUAAAAUCG M24804.1/82-104 UGAGUUCUCUAUCUCUAAAAUCG J04373.1/6212-6234 UAAGUUCUCGAUCUUUAAAAUCG M24803.1/1-23 UAAGUUCUCGAUCUCUAAAAUCG #=GC SS_cons .AAA....<<< |
https://en.wikipedia.org/wiki/Stockholm_format |
| Steel Bank Common Lisp | Steel Bank Common Lisp (SBCL) is a free Common Lisp implementation that features a high-performance native compiler, Unicode support and threading. The name "Steel Bank Common Lisp" is a reference to Carnegie Mellon University Common Lisp from which SBCL forked: Andrew Carnegie made his fortune in the steel industry and Andrew Mellon was a successful banker. | https://en.wikipedia.org/wiki/Steel_Bank_Common_Lisp |
| Stata | Stata is a general-purpose statistical software package created in 1985 by StataCorp. Most of its users work in research, especially in the fields of economics, sociology, political science, biomedicine and epidemiology. Stata's capabilities include data management, statistical analysis, graphics, simulations, regression, and custom programming. It also has a system to disseminate user-written programs that lets it grow continuously. The name Stata is a syllabic abbreviation of the words statistics and data. The FAQ for the official forum of Stata insists that the correct English pronunciation of Stata "must remain a mystery"; any of "Stay-ta", "Sta-ta" or "Stah-ta" are considered acceptable. There are four major builds of each version of Stata: Stata/MP for multiprocessor computers (including dual-core and multicore processors) Stata/SE for large databases Stata/IC, which is the standard version Numerics by Stata, supports any of the data sizes listed above in an embedded environment Small Stata, which was the smaller, student version for educational purchase only is no longer available. | https://en.wikipedia.org/wiki/Stata |
| StarLogo | StarLogo is an agent-based simulation language developed by Mitchel Resnick, Eric Klopfer, and others at MIT Media Lab and MIT Scheller Teacher Education Program in Massachusetts. It is an extension of the Logo programming language, a dialect of Lisp. Designed for education, StarLogo can be used by students to model the behavior of decentralized systems. The first StarLogo ran on a Connection Machine 2 parallel computer. A subsequent version ran on Macintosh computers; this version became known later as MacStarLogo (and now is called MacStarLogo Classic). The current StarLogo is written in Java and works on most computers. StarLogo is also available in a version called OpenStarLogo. The source code for OpenStarLogo is available online, although the license under which it is released is not an open source license according to the Open Source Definition, because of restrictions on the commercial use of the code. StarLogo TNG (The Next Generation) version 1.0 was released in July 2008. It provides a 3D world using OpenGL graphics and a block-based graphical language to increase ease of use and learnability. It is written in C and Java. StarLogo TNG uses "blocks" to put together puzzle-like pieces. StarLogo TNG reads the blocks in the order you fit them together, and sets the program in the Spaceland view. StarLogo is a primary influence for the Kedama particle system, programmed by Yoshiki Oshima, found in the Etoys educational programming environment and language, which can be viewed as a Logo done originally in Squeak Smalltalk. | https://en.wikipedia.org/wiki/StarLogo |
| Standard Portable Intermediate Representation | Standard Portable Intermediate Representation (SPIR) is an intermediate language for parallel compute and graphics by Khronos Group, originally developed for use with OpenCL. SPIR was rewritten into SPIR-V in March 2015. | https://en.wikipedia.org/wiki/Standard_Portable_Intermediate_Representation |
| Standard ML | Standard ML (SML; Standard Meta Language) is a general-purpose, modular, functional programming language with compile-time type checking and type inference. It is popular among compiler writers and programming language researchers, as well as in the development of theorem provers. SML is a modern dialect of ML, the programming language used in the Logic for Computable Functions (LCF) theorem-proving project. It is distinctive among widely used languages in that it has a formal specification, given as typing rules and operational semantics in The Definition of Standard ML (1990, revised and simplified as The Definition of Standard ML (Revised) in 1997). | https://en.wikipedia.org/wiki/Standard_ML |
| Stan | Stan is a probabilistic programming language for statistical inference written in C++. The Stan language is used to specify a (Bayesian) statistical model with an imperative program calculating the log probability density function. Stan is licensed under the New BSD License. Stan is named in honour of Stanislaw Ulam, pioneer of the Monte Carlo method. | https://en.wikipedia.org/wiki/Stan_(software) |
| Stalin | Stalin (STAtic Language ImplementatioN) is an aggressive optimizing batch whole-program Scheme compiler written by Jeffrey Mark Siskind. It uses advanced flow analysis and type inference and a variety of other optimization techniques to produce code. Stalin is intended for production use in generating an optimized executable. The compiler itself runs slowly, and there is little or no support for debugging or other niceties. Full R4RS Scheme is supported, with a few minor and rarely encountered omissions. Interfacing to external C libraries is straightforward. The compiler itself does lifetime analysis and hence does not generate as much garbage as might be expected, but global reclamation of storage is done using the Boehm garbage collector. The name is a joke: "Stalin brutally optimizes." Stalin is free software, licensed under the GNU General Public License (GPL), and is available online. | https://en.wikipedia.org/wiki/Stalin_(Scheme_implementation) |
| Stackless Python | Stackless Python, or Stackless, is a Python programming language interpreter, so named because it avoids depending on the C call stack for its own stack. In practice, Stackless Python uses the C stack, but the stack is cleared between function calls . The most prominent feature of Stackless is microthreads, which avoid much of the overhead associated with usual operating system threads. In addition to Python features, Stackless also adds support for coroutines, communication channels and task serialization. | https://en.wikipedia.org/wiki/Stackless_Python |
| Squirrel | Squirrel is a high level imperative, object-oriented programming language, designed to be a light-weight scripting language that fits in the size, memory bandwidth, and real-time requirements of applications like video games and hardware such as Electric Imp. MirthKit, a simple toolkit for making and distributing open source, cross-platform 2D games, uses Squirrel for its platform. It is used extensively by Code::Blocks for scripting and was also used in Final Fantasy Crystal Chronicles: My Life as a King. It is also used in Left 4 Dead 2, Portal 2 and Thimbleweed Park for scripted events. | https://en.wikipedia.org/wiki/Squirrel_(programming_language) |
| Spyder | Spyder is an open source cross-platform integrated development environment (IDE) for scientific programming in the Python language. Spyder integrates with a number of prominent packages in the scientific Python stack, including NumPy, SciPy, Matplotlib, pandas, IPython, SymPy and Cython, as well as other open source software. It is released under the MIT license.Initially created and developed by Pierre Raybaut in 2009, since 2012 Spyder has been maintained and continuously improved by a team of scientific Python developers and the community. Spyder is extensible with first- and third-party plugins, includes support for interactive tools for data inspection and embeds Python-specific code quality assurance and introspection instruments, such as Pyflakes, Pylint and Rope. It is available cross-platform through Anaconda, on Windows with WinPython and Python (x,y), on macOS through MacPorts, and on major Linux distributions such as Arch Linux, Debian, Fedora, Gentoo Linux, openSUSE and Ubuntu.Spyder uses Qt for its GUI, and is designed to use either of the PyQt or PySide Python bindings. QtPy, a thin abstraction layer developed by the Spyder project and later adopted by multiple other packages, provides the flexibility to use either backend. | https://en.wikipedia.org/wiki/Spyder_(software) |
| Split-C | Split-C is a parallel extension of the C programming language. The Split-C project website describes Split-C as: a parallel extension of the C programming language that supports efficient access to a global address space on current distributed memory multiprocessors. It retains the "small language" character of C and supports careful engineering and optimization of programs by providing a simple, predictable cost model. Development of Split-C appears to be at a standstill since 1996. Split-C is similar to Cilk. | https://en.wikipedia.org/wiki/Split-C |
| Spice Lisp | Spice Lisp is a Lisp dialect and its implementation originally written by CMU's Spice Lisp Group which targeted the microcode of the 16-bit PERQ workstation and its Accent operating system; it used that workstation's microcode abilities (it provided microcodes for Pascal, C, and Ada besides) to implement a stack architecture to store its data structures as 32-bit objects and to enable runtime type-checking. It would later be popular on other workstations. Spice Lisp evolved into CMUCL, a Common Lisp implementation. | https://en.wikipedia.org/wiki/Spice_Lisp |
| MAPPER | Sperry Univac's 'MAPPER 4GL originated in the 1970s based on some work in the 1960s, but has been kept current. It was renamed and also given an extension named ICE - Internet Commerce Enabler.Originally available on Sperry's Univac 1108, implementations now also exist for Windows NT, Sun Solaris and Linux. The GUI on Windows is the most advanced of these. | https://en.wikipedia.org/wiki/MAPPER |
| Speedcoding | Speedcoding or Speedcode was the first high-level programming language created for an IBM computer. The language was developed by John Backus in 1953 for the IBM 701 to support computation with floating point numbers. Here high level means symbolic and aiming for natural language expressivity as a goal as opposed to machine or hardware instruction oriented coding. The idea arose from the difficulty of programming the IBM SSEC machine when Backus was hired to calculate astronomical positions in early 1950. The speedcoding system was an interpreter and focused on ease of use at the expense of system resources. It provided pseudo-instructions for common mathematical functions: logarithms, exponentiation, and trigonometric operations. The resident software analyzed pseudo-instructions one by one and called the appropriate subroutine. Speedcoding was also the first implementation of decimal input/output operations. Although it substantially reduced the effort of writing many jobs, the running time of a program that was written with the help of Speedcoding was usually ten to twenty times that of machine code. The interpreter took 310 memory words, about 30% of the memory available on a 701. | https://en.wikipedia.org/wiki/Speedcoding |
| Spec Sharp | Spec# is a programming language with specification language features that extends the capabilities of the C# programming language with Eiffel-like contracts, including object invariants, preconditions and postconditions. Like ESC/Java, it includes a static checking tool based on a theorem prover that is able to statically verify many of these invariants. It also includes a variety of other minor extensions to the language, such as non-null reference types. The code contracts API in the .NET Framework 4.0 has evolved with Spec#. Microsoft Research developed both Spec# and C#; in turn, Spec# serves as the foundation of the Sing# programming language, which Microsoft Research also developed. | https://en.wikipedia.org/wiki/Spec_Sharp |
| Sing Sharp | Spec# is a programming language with specification language features that extends the capabilities of the C# programming language with Eiffel-like contracts, including object invariants, preconditions and postconditions. Like ESC/Java, it includes a static checking tool based on a theorem prover that is able to statically verify many of these invariants. It also includes a variety of other minor extensions to the language, such as non-null reference types. The code contracts API in the .NET Framework 4.0 has evolved with Spec#. Microsoft Research developed both Spec# and C#; in turn, Spec# serves as the foundation of the Sing# programming language, which Microsoft Research also developed. | https://en.wikipedia.org/wiki/Sing_Sharp |
| Speakeasy | Speakeasy is a numerical computing interactive environment also featuring an interpreted programming language. It was initially developed for internal use at the Physics Division of Argonne National Laboratory by the theoretical physicist Stanley Cohen. He eventually founded Speakeasy Computing Corporation to make the program available commercially. Speakeasy is a very long-lasting numerical package. In fact, the original version of the environment was built around a core dynamic data repository called "Named storage" developed in the early 1960s, while the most recent version has been released in 2006. Speakeasy was aimed to make the computational work of the physicists at the Argonne National Laboratory easier. It was initially conceived to work on mainframes (the only kind of computers at that time), and was subsequently ported to new platforms (minicomputers, personal computers) as they became available. The porting of the same code on different platforms was made easier by using Mortran metalanguage macros to face systems dependencies and compilers deficiencies and differences. Speakeasy is currently available on several platforms : PCs running Windows, macOS, Linux, departmental computers and workstations running several flavors of Linux, AIX or Solaris. Speakeasy was also among the first interactive numerical computing environments, having been implemented in such a way on a CDC 3600 system, and later on IBM TSO machines as one was in beta-testing at the Argonne National Laboratory at the time. Almost since the beginning (as the dynamic linking functionality was made available in the operating systems) Speakeasy features the capability of expanding its operational vocabulary using separated modules, dynamically linked to the core processor as they are needed. For that reason such modules were called "linkules" (LINKable-modULES). They are functions with a generalized interface, which can be written in FORTRAN or in C. The independence of each of the new modules from the others and from the main processor is of great help in improving the system, especially it was in the old days. This easy way of expanding the functionalities of the main processor was often exploited by the users to develop their own specialized packages. Besides the programs, functions and subroutines the user can write in the Speakeasy's own interpreted language, linkules add functionalities carried out with the typical performances of compiled programs. Among the packages developed by the users, one of the most important is "Modeleasy", originally developed as "FEDeasy" in the early 1970s at the research department of the Federal Reserve Board of Governors in Washington D.C.. Modeleasy implements special objects and functions for large econometric models estimation and simulation. Its evolution led eventually to its distribution as an independent product. | https://en.wikipedia.org/wiki/Speakeasy_(computational_environment) |
| Southampton BASIC System | Southampton BASIC System (SOBS) was a dialect of the BASIC programming language developed for and used on ICT 1900 series computers in the late 1960s and early 1970s; it was implemented under the MINIMOP operating system at the University of Southampton and also ran under MAXIMOP. It was operated from a Teletype terminal, though CRT terminals could also be used. | https://en.wikipedia.org/wiki/Southampton_BASIC_System |
| Solidity | Solidity is a contract-oriented programming language for writing smart contracts. It is used for implementing smart contracts on various blockchain platforms. It was developed by Gavin Wood, Christian Reitwiessner, Alex Beregszaszi, Liana Husikyan, Yoichi Hirai and several former Ethereum core contributors to enable writing smart contracts on blockchain platforms such as Ethereum. | https://en.wikipedia.org/wiki/Solidity |
| Snowball | Snowball is a small string processing programming language designed for creating stemming algorithms for use in information retrieval.The Snowball compiler translates a Snowball script (a .sbl file) into either a thread-safe ANSI C program or a Java program. For ANSI C, each Snowball script produces a program file and corresponding header file (with .c and .h extensions). The Snowball compiler checks the consistency of its script, and this check was used to discover a typo in a seminal academic paper by Lovins which had remained undetected for 30 years.The basic datatypes handled by Snowball are strings of characters, signed integers, and boolean truth values, or more simply strings, integers and booleans. Snowball's characters are either 8-bit wide, or 16-bit, depending on the mode of use. In particular, both ASCII and 16-bit Unicode are supported. Like the SNOBOL programming language, the flow of control in Snowball is arranged by the implicit use of signals (each statement returns a true or false value), rather than the explicit use of constructs such as if, then, and break found in C and many other programming languages.The name Snowball was chosen as a tribute to the SNOBOL programming language, with which it shares the concept of string patterns delivering signals that are used to control the flow of the program. The creator of Snowball, Dr. Martin Porter, "toyed with the idea of calling it 'strippergram' ", because it "effectively provides a 'suffix STRIPPER GRAMmar' ". | https://en.wikipedia.org/wiki/Snowball_%28programming_language%29 |
| Snit | Snit or SNIT may refer to: Droopy "Snit" McCool, a minor character in the film Return of the Jedi Snit (horse), a Thoroughbred horse which won the 1997 Cotillion Handicap Snit (mascot), a robotic character on Canadian TV channel YTV Wongsadhiraj Snit, Thai prince honored by UNESCO National System of Land Information or Sistema Nacional de Información Territorial (SNIT), government entity in Chile participating in GeoSUR Shree Narayan Institute of Technology (SNIT), a college in Khargone, India Snit, an object-oriented extension to the Tcl programming language Snit, a unit of measurement for alcoholic drinks Snit, Jamaican name for the fish Haemulon vittatum Šnit, a 2007 Igor Marojević novel Branwell F. Snit, character in a comic strip created by Morgan Sanders Snit Mandolin, main character in the 2009 Canadian film Hungry Hills Snits, West Frisian name for the Dutch city Sneek Snits, creatures in the board game Snit's Revenge | https://en.wikipedia.org/wiki/Snit |
| SnapTag | SnapTag, invented by SpyderLynk, is a 2D mobile barcode alternative similar to a QR code, but that uses an icon or company logo and code ring rather than a square pattern of black dots.Similar to a QR code, SnapTags can be used to take consumers to a brand’s website, but can also facilitate mobile purchases, coupon downloads, free sample requests, video views, promotional entries, Facebook Likes, Pinterest Pins, Twitter Follows, Posts and Tweets. SnapTags offer back-end data mining capabilities. | https://en.wikipedia.org/wiki/SnapTag |
| Snap! | Snap! is a free, blocks- and browser-based educational graphical programming language that allows students to create interactive animations, games, stories, and more, while learning about mathematical and computational ideas. Snap! was inspired by Scratch, but also targets both novice and more advanced students by including and expanding Scratch's features. Since version 4.0, it is entirely browser-based, with no software that needs to be installed on the local device, much like Scratch. | https://en.wikipedia.org/wiki/Snap!_(programming_language) |
| Smile data interchange format | Smile is a computer data interchange format based on JSON. It can also be considered a binary serialization of the generic JSON data model, which means tools that operate on JSON may be used with Smile as well, as long as a proper encoder/decoder exists for the tool. The name comes from first 2 bytes of the 4 byte header, which consist of Smiley ":)" followed by a linefeed: choice made to make it easier to recognize Smile-encoded data files using textual command-line tools. | https://en.wikipedia.org/wiki/Smile_(data_interchange_format) |
| Smarty | Smarty is a web template system written in PHP. Smarty is primarily promoted as a tool for separation of concerns. Smarty is intended to simplify compartmentalization, allowing the front-end of a web page to change separately from its back-end. Ideally, this lowers costs and minimizes the efforts associated with software maintenance. Smarty generates web content through the placement of special Smarty tags within a document. These tags are processed and substituted with other code. Tags are directives for Smarty that are enclosed by template delimiters. These directives can be variables, denoted by a dollar sign ($), functions, logical or loop statements. Smarty allows PHP programmers to define custom functions that can be accessed using Smarty tags. | https://en.wikipedia.org/wiki/Smarty_(template_engine) |
| Smartsheet | Smartsheet is a software as a service (SaaS) application for collaboration and work management that is developed and marketed by Smartsheet Inc. It is used to assign tasks, track project progress, manage calendars, share documents, and manage other work, using a spreadsheet-like user interface. | https://en.wikipedia.org/wiki/Smartsheet |
| Smalltalk | Smalltalk is an object-oriented, dynamically typed, reflective programming language. Smalltalk was created as the language to underpin the "new world" of computing exemplified by "human–computer symbiosis." It was designed and created in part for educational use, more so for constructionist learning, at the Learning Research Group (LRG) of Xerox PARC by Alan Kay, Dan Ingalls, Adele Goldberg, Ted Kaehler, Scott Wallace, and others during the 1970s. The language was first generally released as Smalltalk-80. Smalltalk-like languages are in continuing active development and have gathered loyal communities of users around them. ANSI Smalltalk was ratified in 1998 and represents the standard version of Smalltalk. Smalltalk took second place for "most loved programming language" in the Stack Overflow Developer Survey in 2017. | https://en.wikipedia.org/wiki/Smalltalk |
| Smalltalk MT | Smalltalk MT is an implementation of the Smalltalk programming language created in 1994 by Tarik Kerroum to deal with some of the shortcomings of Smalltalk-80 style of implementations. Smalltalk MT adopts a different approach in that the Smalltalk source is compiled to machine code before being executed. This allows the developer the freedom of working with compiled code without the need for the traditional compile-link-run cycle. This is like a specialized form of incremental or dynamic compilation. Smalltalk MT directly interfaces to DLLs in exactly the same manner as C which allows DLL calls to be tested directly in a Workspace, which allows a scripting style of approach to accessing any DLL based code. For example, one could write in a Workspace the following (single line or multiline, breaking on the '.' character) to reverse the string 'abc': a := 'abc'. WINAPI _strrev: a. a inspect. For 64-bit Windows , try: a:= 'abc'. WINAPI _wcsrev: a. a inspect. The WINAPI call directly calls the DLL function _strrev natively passing parameters from the Smalltalk environment to the C environment and back. Smalltalk MT has a close integration with COM objects and fully compiled COM components can be created that operate in exactly the same way as C/C++ COM objects. In 1998 David Anderson teamed up with Tarik Kerroum to advance Smalltalk MT into the high performance and graphics areas. | https://en.wikipedia.org/wiki/Smalltalk_MT |
| SmallBASIC | SmallBASIC is a BASIC programming language dialect with interpreters released as free software under the GNU General Public License version 2. | https://en.wikipedia.org/wiki/SmallBASIC |
| Small-C | Small-C is both a subset of the C programming language, suitable for resource-limited microcomputers and embedded systems, and an implementation of that subset. Originally valuable as an early compiler for microcomputer systems available during the late 1970s and early 1980s, the implementation has also been useful as an example simple enough for teaching purposes. The original compiler, written in Small-C for the Intel 8080 by Ron Cain, appeared in the May 1980 issue of Dr. Dobb's Journal of Computer Calisthenics & Orthodontia. James E. Hendrix improved and extended the original compiler, and wrote The Small-C Handbook. Ron bootstrapped Small-C on the SRI International PDP 11/45 Unix system with an account provided by John Bass for Small C development. The provided source code was released with management permission into the public domain. Small-C was important for tiny computers in a manner somewhat analogous to the importance of GCC for larger computers. Just like its Unix counterparts, the compiler generates assembler code, which then must be translated to machine code by an available assembler. Small-C is a retargetable compiler. Porting Small-C requires only that the back-end code generator be rewritten for the target processor. | https://en.wikipedia.org/wiki/Small-C |
| Slony | Slony-I is an asynchronous master-slave replication system for the PostgreSQL DBMS, providing support for cascading and failover. Asynchronous means that when a database transaction has been committed to the master server, it is not yet guaranteed to be available in slaves. Cascading means that replicas can be created (and updated) via other replicas, i.e. they needn't directly connect to the master. | https://en.wikipedia.org/wiki/Slony-I |
| Sketchpad | Sketchpad (a.k.a. Robot Draftsman) was a computer program written by Ivan Sutherland in 1963 in the course of his PhD thesis, for which he received the Turing Award in 1988, and the Kyoto Prize in 2012. It pioneered the way for human–computer interaction (HCI). Sketchpad is considered to be the ancestor of modern computer-aided design (CAD) programs as well as a major breakthrough in the development of computer graphics in general. For example, the graphical user interface (GUI) was derived from the Sketchpad as well as modern object oriented programming. Ivan Sutherland demonstrated with it that computer graphics could be used for both artistic and technical purposes in addition to showing a novel method of human-computer interaction. | https://en.wikipedia.org/wiki/Sketchpad |
| SipHash | SipHash is an add–rotate–xor (ARX) based family of pseudorandom functions created by Jean-Philippe Aumasson and Daniel J. Bernstein in 2012, in response to a spate of "hash flooding" denial-of-service attacks in late 2011.Although designed for use as a hash function in the computer science sense, SipHash is fundamentally different from cryptographic hash functions like SHA in that it is only suitable as a message authentication code: a keyed hash function like HMAC. That is, SHA is designed so that it is difficult for an attacker to find two messages X and Y such that SHA(X) = SHA(Y), even though anyone may compute SHA(X). SipHash instead guarantees that, having seen Xi and SipHash(Xi, k), an attacker who does not know the key k cannot find (any information about) k or SipHash(Y, k) for any message Y ∉ {Xi} which they have not seen before. | https://en.wikipedia.org/wiki/SipHash |
| SA-C | Single Assignment C (SA-C) (pronounced "sassy") is a member of the C programming language family designed to be directly and intuitively translatable into circuits, including FPGAs. To ease translation, SA-C does not include pointers and arithmetics thereon. To retain most of the expressiveness of C, SA-C instead features true n-dimensional arrays as first-class objects of the language. | https://en.wikipedia.org/wiki/SA-C_%28programming_language%29 |
| Sinclair BASIC | Sinclair BASIC is a dialect of the programming language BASIC used in the 8-bit home computers from Sinclair Research and Timex Sinclair. The Sinclair BASIC interpreter was made by Nine Tiles Networks Ltd. | https://en.wikipedia.org/wiki/Sinclair_BASIC |
| Simulink | Simulink, developed by MathWorks, is a graphical programming environment for modeling, simulating and analyzing multidomain dynamical systems. Its primary interface is a graphical block diagramming tool and a customizable set of block libraries. It offers tight integration with the rest of the MATLAB environment and can either drive MATLAB or be scripted from it. Simulink is widely used in automatic control and digital signal processing for multidomain simulation and Model-Based Design. | https://en.wikipedia.org/wiki/Simulink |
| Simula | Simula is the name of two simulation programming languages, Simula I and Simula 67, developed in the 1960s at the Norwegian Computing Center in Oslo, by Ole-Johan Dahl and Kristen Nygaard. Syntactically, it is a fairly faithful superset of ALGOL 60. Simula 67 introduced objects, classes, inheritance and subclasses, virtual procedures, coroutines, and discrete event simulation, and features garbage collection. Also other forms of subtyping (besides inheriting subclasses) were introduced in Simula derivatives. Simula is considered the first object-oriented programming language. As its name suggests, Simula was designed for doing simulations, and the needs of that domain provided the framework for many of the features of object-oriented languages today. Simula has been used in a wide range of applications such as simulating VLSI designs, process modeling, protocols, algorithms, and other applications such as typesetting, computer graphics, and education. The influence of Simula is often understated, and Simula-type objects are reimplemented in C++, Object Pascal, Java, C# and several other languages. Computer scientists such as Bjarne Stroustrup, creator of C++, and James Gosling, creator of Java, have acknowledged Simula as a major influence. | https://en.wikipedia.org/wiki/Simula |
| SMTP | Simple Mail Transfer Protocol (SMTP) is an Internet standard for electronic mail (email) transmission. First defined by RFC 821 in 1982, it was last updated in 2008 with Extended SMTP additions by RFC 5321, which is the protocol in widespread use today. Although electronic mail servers and other mail transfer agents use SMTP to send and receive mail messages, user-level client mail applications typically use SMTP only for sending messages to a mail server for relaying. For retrieving messages, client applications usually use either IMAP or POP3. SMTP communication between mail servers uses TCP port 25. Mail clients on the other hand, often submit the outgoing emails to a mail server on port 587. Despite being deprecated, mail providers sometimes still permit the use of nonstandard port 465 for this purpose. SMTP connections secured by TLS, known as SMTPS, can be made using STARTTLS. Although proprietary systems (such as Microsoft Exchange and IBM Notes) and webmail systems (such as Outlook.com, Gmail and Yahoo! Mail) use their own non-standard protocols to access mail box accounts on their own mail servers, all use SMTP when sending or receiving email from outside their own systems. | https://en.wikipedia.org/wiki/Simple_Mail_Transfer_Protocol |
| Silicon Graphics Image | Silicon Graphics Image (SGI) or the RGB file format is the native raster graphics file format for Silicon Graphics workstations. The format was invented by Paul Haeberli. It can be run-length encoded (RLE). Among others FFmpeg and ImageMagick support this format. | https://en.wikipedia.org/wiki/Silicon_Graphics_Image |
| Sieve mail filtering language | Sieve is a programming language that can be used for email filtering. It owes its creation to the CMU Cyrus Project, creators of Cyrus IMAP server. The language is not tied to any particular operating system or mail architecture. It requires the use of RFC 2822-compliant messages, but otherwise should generalize to other systems that meet these criteria. The current version of Sieve's base specification is outlined in RFC 5228, published in January 2008. | https://en.wikipedia.org/wiki/Sieve_(mail_filtering_language) |
| Sibelius | Sibelius is a scorewriter program developed and released by Sibelius Software Limited (now part of Avid Technology). It is the world's largest selling music notation program. Beyond creating, editing and printing music scores, Sibelius can also play the music back using sampled or synthesised sounds. It produces printed scores, and can also publish them via the Internet for others to access. Less advanced versions of Sibelius at lower prices have been released, as have various add-ons for the software. Named after the Finnish composer Jean Sibelius, the company was founded in April 1993 by twin brothers Ben and Jonathan Finn to market the eponymous music notation program they had created. It went on to develop and distribute various other music software products, particularly for education. In addition to its head office in Cambridge and subsequently London, Sibelius Software opened offices in the US, Australia and Japan, with distributors and dealers in many other countries worldwide. The company won numerous awards, including the Queen's Award for Innovation in 2005. In August 2006 the company was acquired by Avid, to become part of its Digidesign division, which also manufactures the leading digital audio workstation Pro Tools. In July 2012, Avid announced plans to divest its consumer businesses, closed the Sibelius London office, and removed the original development team, despite extensive protests on Facebook and elsewhere. Avid subsequently recruited some new programmers to continue development of Sibelius. | https://en.wikipedia.org/wiki/Sibelius_(software) |
| Short Code computer language | Short Code was one of the first higher-level languages ever developed for an electronic computer. Unlike machine code, Short Code statements represented mathematic expressions rather than a machine instruction. Also known as an automatic programming, the source code was not compiled but executed through an interpreter to simplify the programming process; the execution time was much slower though. | https://en.wikipedia.org/wiki/Short_Code_(computer_language) |
| SheerPower4GL | SheerPower 4GL is a Fourth-generation programming language developed by Touch Technologies, Inc [1]. SheerPower 4GL is the result of porting Touch Technologies' Intouch 4GL programming language that runs on OpenVMS (for DEC Alpha and VAX computers) to Windows, launching in 2000. Downloads are free from the official SheerPower 4GL website.[2] SheerPower 4GL is similar to the BASIC programming language, and is easy to learn. | https://en.wikipedia.org/wiki/SheerPower4GL |
| ShEx | Shape Expressions (ShEx) is a language for validating and describing RDF. It was proposed at the 2012 RDF Validation Workshop as a high-level, concise language for RDF validation. The shapes can be defined in a human-friendly compact syntax called ShExC or using any Resource Description Framework (RDF) serialization formats like JSON-LD or Turtle. ShEx expressions can be used both to describe RDF and to automatically check the conformance of RDF data. The syntax of ShEx is similar to Turtle and SPARQL while the semantics is inspired by regular expression languages like RelaxNG. | https://en.wikipedia.org/wiki/ShEx |
| Service Modeling Language | Service Modeling Language (SML) and Service Modeling Language Interchange Format (SML-IF) are a pair of XML-based specifications created by leading information technology companies that define a set of XML instance document extensions for expressing links between elements, a set of XML Schema extensions for constraining those links, and a way to associate Schematron rules with global element declarations, global complex type definitions, and/or model documents. The SML specification defines model concepts, and the SML-IF specification describes a packaging format for exchanging SML-based models. SML and SML-IF were standardized in a W3C working group chartered to produce W3C Recommendations for the Service Modeling Language by refining the “Service Modeling Language” (SML) Member Submission, addressing implementation experience and feedback on the specifications. The submission was from an industry group consisting of representatives from BEA Systems, BMC, CA, Cisco, Dell, EMC, HP, IBM, Intel, Microsoft, and Sun Microsystems. They were published as W3C Recommendations on May 12, 2009. In the market and in applying by vendors, SML is seen as a successor/replacement for earlier developed standards like DCML and Microsoft's (in hindsight) proprietary System Definition Model or SDM. See for a historically helpful relation between SDM and DCML, and for the joint pressrelease announcing SML. In the Microsoft section of it the sequel role to SDM is mentioned. | https://en.wikipedia.org/wiki/Service_Modeling_Language |
| SSI | Server Side Includes (SSI) is a simple interpreted server-side scripting language used almost exclusively for the Web. Code is processed by web servers. The most frequent use of SSI is to include the contents of one or more files into a web page on a web server. For example, a web page containing a daily quotation could include the quotation by placing the following code into the file of the web page: With one change of the quote.txt file, all pages that include the file will display the latest daily quotation. The inclusion is not limited to files, and may also be the text output from a program, or the value of a system variable such as the current time. Server Side Includes are useful for including a common piece of code throughout a site, such as a page header, a page footer and a navigation menu. Conditional navigation menus can be conditionally included using control directives. In order for a web server to recognize an SSI-enabled HTML file and therefore carry out these instructions, either the filename should end with a special extension, by default .shtml, .stm, .shtm, or, if the server is configured to allow this, set the execution bit of the file.As a simple programming language, SSI supports only one type: text. Its control flow is rather simple, choice is supported, but loops are not natively supported and can only be done by recursion using include or using HTTP redirect. The simple design of the language makes it easier to learn and use than most server-side scripting languages, while complicated server-side processing is often done with one of the more feature-rich programming languages. SSI is Turing complete.Apache, LiteSpeed, nginx, and IIS are the four major web servers that support this language. SSI has a simple syntax: . Directives are placed in HTML comments so that if SSI is not enabled, users will not see the SSI directives on the page, unless they look at its source. Note that the syntax does not allow spaces between the leading "<" and the directive. | https://en.wikipedia.org/wiki/Server_Side_Includes |
| SFC | Sequential function chart (SFC) is a graphical programming language used for programmable logic controllers (PLCs). It is one of the five languages defined by IEC 61131-3 standard. The SFC standard is defined as, Preparation of function charts for control systems, and was based on GRAFCET (itself based on binary Petri nets). It can be used to program processes that can be split into steps. Main components of SFC are: Steps with associated actions; Transitions with associated logic conditions; Directed links between steps and transitions.Steps in an SFC diagram can be active or inactive. Actions are only executed for active steps. A step can be active for one of two motives: It is an initial step as specified by the programmer. It was activated during a scan cycle and not deactivated since.Steps are activated when all steps above it are active and the connecting transition is superable (i.e. its associated condition is true). When a transition is passed, all steps above are deactivated at once and after all steps below are activated at once. Actions associated with steps can be of several types, the most relevant ones being Continuous (N), Set (S) and Reset (R). Apart from the obvious meaning of Set and Reset, an N action ensures that its target variable is set to 1 as long as the step is active. An SFC rule states that if two steps have an N action on the same target, the variable must never be reset to 0. It is also possible to insert LD (Ladder Diagram) actions inside an SFC program (and this is the standard way, for instance, to work on integer variables). SFC is an inherently parallel language in that multiple control flows — Program Organization Units (POUs) in the standard's parlance — can be active at once. Non-standard extensions to the language include macroactions: i.e. actions inside a program unit that influence the state of another program unit. The most relevant such macroaction is "forcing", in which a POU can decide the active steps of another POU. | https://en.wikipedia.org/wiki/Sequential_function_chart |
| SequenceL | SequenceL is a general purpose functional programming language and auto-parallelizing (Parallel computing) compiler and tool set, whose primary design objectives are performance on multi-core processor hardware, ease of programming, platform portability/optimization, and code clarity and readability. Its main advantage is that it can be used to write straightforward code that automatically takes full advantage of all the processing power available, without programmers needing to be concerned with identifying parallelisms, specifying vectorization, avoiding race conditions, and other challenges of manual directive-based programming approaches such as OpenMP. Programs written in SequenceL can be compiled to multithreaded code that runs in parallel, with no explicit indications from a programmer of how or what to parallelize. As of 2015, versions of the SequenceL compiler generate parallel code in C++ and OpenCL, which allows it to work with most popular programming languages, including C, C++, C#, Fortran, Java, and Python. A platform-specific runtime manages the threads safely, automatically providing parallel performance according to the number of cores available, currently supporting x86, OpenPOWER/POWER8, and ARM platforms. | https://en.wikipedia.org/wiki/SequenceL |
| SAM file format | Sequence Alignment Map (SAM) is a text-based format for storing biological sequences aligned to a reference sequence developed by Heng Li and Bob Handsaker et al. It is widely used for storing data, such as nucleotide sequences, generated by next generation sequencing technologies. The format supports short and long reads (up to 128Mbp) produced by different sequencing platforms and is used to hold mapped data within the Genome Analysis Toolkit (GATK) and across the Broad Institute, the Wellcome Sanger Institute, and throughout the 1000 Genomes Project. Sequence Alignment/Map (SAM) format for alignment of nucleotide sequences (e.g. sequencing reads) to (a) reference sequence(s). May contain base-call and alignment qualities and other data. | https://en.wikipedia.org/wiki/SAM_(file_format) |
| SenseTalk | SenseTalk is an English-like scripting language derived from the HyperTalk language used in HyperCard. SenseTalk was originally developed as the scripting language within the HyperSense multimedia authoring application on the NeXTStep and OpenStep platforms. SenseTalk resurfaced in 2002 as the scripting language in eggPlant, the first commercial Mac OS X and cross-platform GUI testing application. | https://en.wikipedia.org/wiki/SenseTalk |
| Self | Self is an object-oriented programming language based on the concept of prototypes. Self began as a dialect of Smalltalk, being dynamically typed and using just-in-time compilation (JIT) as well as the prototype-based approach to objects: it was first used as an experimental test system for language design in the 1980s and 1990s. In 2006, Self was still being developed as part of the Klein project, which was a Self virtual machine written fully in Self. The latest version is 2017.1 released in May 2017. Several just-in-time compilation techniques were pioneered and improved in Self research as they were required to allow a very high level object oriented language to perform at up to half the speed of optimized C. Much of the development of Self took place at Sun Microsystems, and the techniques they developed were later deployed for Java's HotSpot virtual machine. At one point a version of Smalltalk was implemented in Self. Because it was able to use the JIT, this also gave extremely good performance. | https://en.wikipedia.org/wiki/Self_(programming_language) |
| Seed7 | Seed7 is an extensible general-purpose programming language designed by Thomas Mertes. It is syntactically similar to Pascal and Ada. Along with many other features, it provides an extension mechanism. Seed7 supports introducing new syntax elements and their semantics into the language, and allows new language constructs to be defined and written in Seed7. For example, programmers can introduce syntax and semantics of new statements and user defined operator symbols. The implementation of Seed7 differs significantly from that of languages with hard-coded syntax and semantics. | https://en.wikipedia.org/wiki/Seed7 |
| PICO | See also Pico (disambiguation).Pico is a programming language developed at the Software Languages Lab at Vrije Universiteit Brussel. The language was created to introduce the essentials of programming to non-computer science students. Pico can be seen as an effort to generate a palatable and enjoyable language for people who do not want to study hard for the elegance and power of a language. They have done it by adapting Scheme's semantics. While designing Pico, the Software Languages Lab was inspired by the Abelson and Sussman's book "Structure and Interpretation of Computer Programs". Furthermore, they were influenced by the teaching of programming at high school or academic level. Pico should be interpreted as 'small', the idea was to create a small language for educational purposes. | https://en.wikipedia.org/wiki/Pico_(programming_language) |
| Security Assertion Markup Language | Security Assertion Markup Language (SAML, pronounced sam-el) is an open standard for exchanging authentication and authorization data between parties, in particular, between an identity provider and a service provider. As its name implies, SAML is an XML-based markup language for security assertions (statements that service providers use to make access-control decisions). SAML is also: A set of XML-based protocol messages A set of protocol message bindings A set of profiles (utilizing all of the above)The single most important use case that SAML addresses is web browser single sign-on (SSO). Single sign-on is relatively easy to accomplish within a security domain (using cookies, for example) but extending SSO across security domains is more difficult and resulted in the proliferation of non-interoperable proprietary technologies. The SAML Web Browser SSO profile was specified and standardized to promote interoperability. (For comparison, the more recent OpenID Connect protocol is an alternative approach to web browser SSO.) | https://en.wikipedia.org/wiki/Security_Assertion_Markup_Language |
| Linden Scripting Language | Second Life is an online virtual world, developed and owned by the San Francisco-based firm Linden Lab and launched on June 23, 2003. By 2013, Second Life had approximately one million regular users. In many ways, Second Life is similar to massively multiplayer online role-playing games; however, Linden Lab is emphatic that their creation is not a game: "There is no manufactured conflict, no set objective".The virtual world can be accessed freely via Linden Lab's own client programs or via alternative third-party viewers. Second Life users, also called residents, create virtual representations of themselves, called avatars, and are able to interact with places, objects and other avatars. They can explore the world (known as the grid), meet other residents, socialize, participate in both individual and group activities, build, create, shop, and trade virtual property and services with one another. The platform principally features 3D-based user-generated content. Second Life also has its own virtual currency, the Linden Dollar, which is exchangeable with real world currency.Second Life is intended for people aged 16 and over, with the exception of 13–15-year-old users, who are restricted to the Second Life region of a sponsoring institution (e.g., a school).Built into the software is a 3D modeling tool based on simple geometric shapes that allows residents to build virtual objects. There is also a procedural scripting language, Linden Scripting Language, which can be used to add interactivity to objects. Sculpted prims (sculpties), mesh, textures for clothing or other objects, animations, and gestures can be created using external software and imported. The Second Life terms of service provide that users retain copyright for any content they create, and the server and client provide simple digital rights management (DRM) functions. However, Linden Lab changed their terms of service in August 2013 to be able to use user-generated content for any purpose. The new terms of service prevent users from using textures from third-party texture services, as some of them pointed out explicitly. | https://en.wikipedia.org/wiki/Linden_Scripting_Language |
| SdlBasic | SdlBasic is a multiplatform interpreter for BASIC, using the SDL libraries. Its interpreter core is based on wxBasic. The interpreter can be very useful for people who are familiar with ANSI-BASIC interpreters and are curious or needing SDL library features on their coding development. Using the IDE it is possible to create an executable. | https://en.wikipedia.org/wiki/SdlBasic |
| Scsh | Scsh (a Scheme shell) is computer software, a type of shell for an operating system. It is a Portable Operating System Interface (POSIX) application programming interface (API) layered on the programming language Scheme, in a manner to make the most of Scheme's ability for scripting. Scsh is limited to 32-bit platforms but there is a development version against the latest Scheme 48 that works in 64-bit mode. It is free and open-source software released under a BSD license. | https://en.wikipedia.org/wiki/Scsh |
| Scriptol | Scriptol is an object-oriented programming language that allows users to declare an XML document as a class. The language is universal and allows users to create dynamic web pages, as well as create scripts and binary applications. | https://en.wikipedia.org/wiki/Scriptol |
| ScriptBasic | ScriptBasic is a scripting language variant of BASIC. The source of the interpreter is available as a C program under the LGPL license. ScriptBasic generates intermediary code which is then interpreted by a runtime environment. ScriptBasic is available for Windows, Unix and Mac OS X and may be embedded in other programs as well. It can create standalone executable files. A runtime library is linked into the executable. It is available in precompiled binaries (setup.exe under Windows and uninstall also supported), dpkg and rpm for Linux and in source code form. The language, the interpreter is fully documented in the Users' Guide available in text, HTML, HTML Help, TeX, texi and PDF formats. ScriptBasic has been developed since 1999 and has reached a fairly matured state in terms of functions and stability. The precompiled version available for Windows and Linux includes a command line version and a standalone web server. This BASIC can be the choice for developers, who seek a BASIC variant that runs on UNIX as well as under Windows and Mac OS X (Intel). The Basic is embeddable with an option to compile your applications to a small footprint executable. ScriptBasic has an open interface for module developers. There are several external modules developed by the developer of ScriptBasic as well as by other developers. These include data base connection handling for various database systems (MySQL, PostgreSQL, ODBC, Berkeley DB and others), binding to the library CURL, PNG graphics, GTK+ graphical user interface, sockets, regular expressions, thread support, data compression and CGI. ScriptBasic also has an open interface for preprocessor developers. These are modules that may act not only during run-time but also compile time, thus making it possible to alter the language. Currently there is a single preprocessor that delivers debugger functionality. This lets the BASIC programmer run the BASIC program line by line, examine variable contents, set break points and all the usual debugging features. This debugger supports not only the command line version but also the web server implementation allowing full interactive debugging of CGI applications in BASIC. The architecture of the interpreter internally is object oriented and provides a clean and well documented interface to embed the interpreter into any application written in C or C++. The whole source code is extensively documented and commented, which is an outstanding feature compared to other embeddable script language implementations. Slides in HTML format with English narration in RealAudio format are also available to get a jump start learning the architecture and module, preprocessor and embedding developments. ScriptBasic is supported by a forum. | https://en.wikipedia.org/wiki/ScriptBasic |
| Script.NET | Script.NET or S# is a metaprogramming language that provides scripting functionality in Microsoft .NET applications, allowing runtime execution of custom functionality, similar to VBA in Microsoft Office applications. The syntax of Script.NET is similar to JavaScript. It is designed to be simple and efficient scripting language allowing to customize .NET applications. The language has a true runtime interpreter, and it is executed without generating additional in-memory assemblies. Script.NET is an open-source project. | https://en.wikipedia.org/wiki/Script.NET |
| Scribe | Scribe is a markup language and word processing system which pioneered the use of descriptive markup. Scribe was revolutionary when it was proposed, because it involved for the first time a clean separation of presentation and content. | https://en.wikipedia.org/wiki/Scribe_(markup_language) |
| Scratchpad | Scratchpad may refer to: A pad of paper, such as a notebook, for preliminary notes, sketches, or writings Scratchpad memory, also known as scratchpad, scratchpad RAM or local store. is a high-speed internal memory used for temporary storage of calculations, data, and other work in progress Scratchpad, the former name of Axiom, a free, general-purpose computer algebra system | https://en.wikipedia.org/wiki/Scratchpad |
| Scratch | Scratch is a free visual programming language developed by the MIT Media Lab. Scratch was created to help young people learn to think creatively, reason systematically and work collaboratively. It is used by students, teachers and parents to easily create interactive stories, animations, games, etc. It provides a stepping stone to the world of computer programming. It can also be used for a range of educational and entertainment constructionist purposes from math and science projects, including simulations and visualizations of experiments, recording lectures with animated presentations, to social sciences animated stories, and interactive art. | https://en.wikipedia.org/wiki/Scratch_(programming_language) |
| Scilab | Scilab is an open source, cross-platform numerical computational package and a high-level, numerically oriented programming language. It can be used for signal processing, statistical analysis, image enhancement, fluid dynamics simulations, numerical optimization, and modeling, simulation of explicit and implicit dynamical systems and (if the corresponding toolbox is installed) symbolic manipulations. Scilab is one of the two major open-source alternatives to MATLAB, the other one being GNU Octave. Scilab is similar enough to MATLAB that some book authors (who use it) argue that it is easy to transfer skills between the two systems. Scilab however puts less emphasis on (bidirectional) syntactic compatibility with MATLAB than Octave does. | https://en.wikipedia.org/wiki/Scilab |
| Scikit-learn | Scikit-learn (formerly scikits.learn) is a free software machine learning library for the Python programming language. It features various classification, regression and clustering algorithms including support vector machines, random forests, gradient boosting, k-means and DBSCAN, and is designed to interoperate with the Python numerical and scientific libraries NumPy and SciPy. | https://en.wikipedia.org/wiki/Scikit-learn |
| SciPy | SciPy (pronounced "Sigh Pie") is an open source Python library used for scientific computing and technical computing. SciPy contains modules for optimization, linear algebra, integration, interpolation, special functions, FFT, signal and image processing, ODE solvers and other tasks common in science and engineering. SciPy builds on the NumPy array object and is part of the NumPy stack which includes tools like Matplotlib, pandas and SymPy, and an expanding set of scientific computing libraries. This NumPy stack has similar users to other applications such as MATLAB, GNU Octave, and Scilab. The NumPy stack is also sometimes referred to as the SciPy stack. SciPy is also a family of conferences for users and developers of these tools: SciPy (in the United States), EuroSciPy (in Europe) and SciPy.in (in India). Enthought originated the SciPy conference in the United States and continues to sponsor many of the international conferences as well as host the SciPy website. The SciPy library is currently distributed under the BSD license, and its development is sponsored and supported by an open community of developers. It is also supported by Numfocus which is a community foundation for supporting reproducible and accessible science. | https://en.wikipedia.org/wiki/SciPy |
| Scheme | Scheme is a functional programming language and one of the two main dialects of the programming language Lisp. Unlike Common Lisp, the other main dialect, Scheme follows a minimalist design philosophy specifying a small standard core with powerful tools for language extension. Scheme was created during the 1970s at the MIT AI Lab and released by its developers, Guy L. Steele and Gerald Jay Sussman, via a series of memos now known as the Lambda Papers. It was the first dialect of Lisp to choose lexical scope and the first to require implementations to perform tail-call optimization, giving stronger support for functional programming and associated techniques such as recursive algorithms. It was also one of the first programming languages to support first-class continuations. It had a significant influence on the effort that led to the development of Common Lisp. The Scheme language is standardized in the official IEEE standard and a de facto standard called the Revisedn Report on the Algorithmic Language Scheme (RnRS). The most widely implemented standard is R5RS (1998); a new standard, R6RS, was ratified in 2007. Scheme has a diverse user base due to its compactness and elegance, but its minimalist philosophy has also caused wide divergence between practical implementations, so much that the Scheme Steering Committee calls it "the world's most unportable programming language" and "a family of dialects" rather than a single language. | https://en.wikipedia.org/wiki/Scheme_(programming_language) |
| Schematron | Schematron is a rule-based validation language for making assertions about the presence or absence of patterns in XML trees. It is a structural schema language expressed in XML using a small number of elements and XPath. In a typical implementation, the Schematron schema XML is processed into normal XSLT code for deployment anywhere that XSLT can be used. Schematron is capable of expressing constraints in ways that other XML schema languages like XML Schema and DTD cannot. For example, it can require that the content of an element be controlled by one of its siblings. Or it can request or require that the root element, regardless of what element that is, must have specific attributes. Schematron can also specify required relationships between multiple XML files. Constraints and content rules may be associated with "plain-English" validation error messages, allowing translation of numeric Schematron error codes into meaningful user error messages. The current ISO recommendation is Information technology, Document Schema Definition Languages (DSDL), Part 3: Rule-based validation, Schematron (ISO/IEC 19757-3:2016). | https://en.wikipedia.org/wiki/Schematron |
| Schema.org | Schema.org is an initiative launched on 2 June 2011 by Bing, Google and Yahoo! (then operators of the world's largest search engines) to “create and support a common set of schemas for structured data markup on web pages.” In November 2011 Yandex (whose search engine is the largest one in Russia) joined the initiative. They propose using the schema.org vocabulary along with the Microdata, RDFa, or JSON-LD formats to mark up website content with metadata about itself. Such markup can be recognized by search engine spiders and other parsers, thus gaining access to the meaning of the sites (see Semantic Web). The initiative also describes an extension mechanism for adding additional properties. Public discussion of the initiative largely takes place on the W3C public vocabularies mailing list. In 2012, the GoodRelations ontology was integrated into Schema.org. Much of the vocabulary on schema.org was inspired by earlier formats such as Microformats, FOAF, and OpenCyc. Microformats, with its most dominant representative hCard, continue (as of 2015) to be published widely in the Web, where the deployment of schema.org has strongly increased between 2012 and end 2014. To test the validity of the data marked up with the schemas and Microdata, such validators as the Google Structured Data Testing Tool, Yandex Microformat validator and Bing Markup Validator can be used. Some Schema markups such as Organization and Person are used to influence Google's Knowledge Graph results. | https://en.wikipedia.org/wiki/Schema.org |
| Schema for Object-Oriented XML | Schema for Object-Oriented XML, or SOX, is an XML schema language developed by Commerce One. In 1998 a SOX specification was submitted to the World Wide Web Consortium and published as a W3C Note. A revised version, SOX 2.0, was published as a W3C Note in 1999. SOX was one of several predecessors of the W3C's XML Schema language. After the publication of XML Schema, SOX continued to be supported by Commerce One until the company's bankruptcy in late 2004. The patents for SOX and other Commerce One technologies were purchased by Novell, Inc. in December 2004, reportedly in an effort to prevent them from being exploited by unrelated companies whose primary business is filing patent-related lawsuits. | https://en.wikipedia.org/wiki/Schema_for_Object-Oriented_XML |
| SVG | Scalable Vector Graphics (SVG) is an XML-based vector image format for two-dimensional graphics with support for interactivity and animation. The SVG specification is an open standard developed by the World Wide Web Consortium (W3C) since 1999. SVG images and their behaviors are defined in XML text files. This means that they can be searched, indexed, scripted, and compressed. As XML files, SVG images can be created and edited with any text editor, as well as with drawing software. All major modern web browsers—including Mozilla Firefox, Internet Explorer, Google Chrome, Opera, Safari, and Microsoft Edge—have SVG rendering support. | https://en.wikipedia.org/wiki/Scalable_Vector_Graphics |
| Scala.js | Scala ( SKAH-lah) is a general-purpose programming language providing support for functional programming and a strong static type system. Designed to be concise, many of Scala's design decisions aimed to address criticisms of Java.Scala source code is intended to be compiled to Java bytecode, so that the resulting executable code runs on a Java virtual machine. Scala provides language interoperability with Java, so that libraries written in both languages may be referenced directly in Scala or Java code. Like Java, Scala is object-oriented, and uses a curly-brace syntax reminiscent of the C programming language. Unlike Java, Scala has many features of functional programming languages like Scheme, Standard ML and Haskell, including currying, type inference, immutability, lazy evaluation, and pattern matching. It also has an advanced type system supporting algebraic data types, covariance and contravariance, higher-order types (but not higher-rank types), and anonymous types. Other features of Scala not present in Java include operator overloading, optional parameters, named parameters, and raw strings. Conversely, a feature of Java not in Scala is checked exceptions, which have proved controversial.The name Scala is a portmanteau of scalable and language, signifying that it is designed to grow with the demands of its users. | https://en.wikipedia.org/wiki/Scala.js_(programming_language) |
| Scala | Scala ( SKAH-lah) is a general-purpose programming language providing support for functional programming and a strong static type system. Designed to be concise, many of Scala's design decisions aimed to address criticisms of Java. Scala source code is intended to be compiled to Java bytecode, so that the resulting executable code runs on a Java virtual machine. Scala provides language interoperability with Java, so that libraries written in both languages may be referenced directly in Scala or Java code. Like Java, Scala is object-oriented, and uses a curly-brace syntax reminiscent of the C programming language. Unlike Java, Scala has many features of functional programming languages like Scheme, Standard ML and Haskell, including currying, type inference, immutability, lazy evaluation, and pattern matching. It also has an advanced type system supporting algebraic data types, covariance and contravariance, higher-order types (but not higher-rank types), and anonymous types. Other features of Scala not present in Java include operator overloading, optional parameters, named parameters, and raw strings. Conversely, a feature of Java not in Scala is checked exceptions, which have proved controversial. The name Scala is a portmanteau of scalable and language, signifying that it is designed to grow with the demands of its users. | https://en.wikipedia.org/wiki/Scala_(programming_language) |
| Sawzall | Sawzall is a procedural domain-specific programming language, used by Google to process large numbers of individual log records. Sawzall was first described in 2003, and the szl runtime was open-sourced in August 2010. However, since the MapReduce table aggregators have not been released, the open-sourced runtime is not useful for large-scale data analysis of multiple log files off the shelf. Sawzall has been replaced by Lingo (logs in Go) for most purposes within Google. | https://en.wikipedia.org/wiki/Sawzall_(programming_language) |
| Sather | Sather is an object-oriented programming language. It originated circa 1990 at the International Computer Science Institute (ICSI) at the University of California, Berkeley, developed by an international team led by Steve Omohundro. It supports garbage collection and generics by subtypes. Originally, it was based on Eiffel, but it has diverged, and now includes several functional programming features. It is probably best to view it as an object-oriented language, with many ideas borrowed from Eiffel. Even the name is inspired by Eiffel; the Sather Tower is a recognizable landmark at Berkeley, named after Jane Krom Sather, the widow of Peder Sather, who donated large sums to the foundation of the university. Sather also takes inspiration from other programming languages and paradigms: iterators, design by contract, abstract classes, multiple inheritance, anonymous functions, operator overloading, contravariant type system. The original Berkeley implementation (last stable version 1.1 was released in 1995, no longer maintained) has been adopted by the Free Software Foundation therefore becoming GNU Sather. Last stable GNU version (1.2.3) was released in July 2007 and the software is currently not maintained. There were several other variants: Sather-K from the University of Karlsruhe; Sather-W from the University of Waikato (implementation of Sather version 1.3); Peter Naulls' port of ICSI Sather 1.1 to RISC OS; and pSather, a parallel version of ICSI Sather addressing non-uniform memory access multiprocessor architectures but presenting a shared memory model to the programmer. The former ICSI Sather compiler (now GNU Sather) is implemented as a compiler to C, i.e., the compiler does not output object or machine code, but takes Sather source code and generates C source code as an intermediate language. Optimizing is left to the C compiler. The GNU Sather compiler, written in Sather itself, is dual licensed under the GNU GPL & LGPL. | https://en.wikipedia.org/wiki/Sather |
| Sass | Sass (syntactically awesome stylesheets) is a style sheet language initially designed by Hampton Catlin and developed by Natalie Weizenbaum. After its initial versions, Weizenbaum and Chris Eppstein continued to extend Sass with SassScript, a simple scripting language used in Sass files. Sass is a scripting language that is interpreted or compiled into Cascading Style Sheets (CSS). SassScript is the scripting language itself. Sass consists of two syntaxes. The original syntax, called "the indented syntax", uses a syntax similar to Haml. It uses indentation to separate code blocks and newline characters to separate rules. The newer syntax, "SCSS", uses block formatting like that of CSS. It uses braces to denote code blocks and semicolons to separate lines within a block. The indented syntax and SCSS files are traditionally given the extensions .sass and .scss, respectively. CSS3 consists of a series of selectors and pseudo-selectors that group rules that apply to them. Sass (in the larger context of both syntaxes) extends CSS by providing several mechanisms available in more traditional programming languages, particularly object-oriented languages, but that are not available to CSS3 itself. When SassScript is interpreted, it creates blocks of CSS rules for various selectors as defined by the Sass file. The Sass interpreter translates SassScript into CSS. Alternatively, Sass can monitor the .sass or .scss file and translate it to an output .css file whenever the .sass or .scss file is saved. Sass is simply syntactic sugar for CSS. The official implementation of Sass is open-source and coded in Ruby; however, other implementations exist, including PHP, and a high-performance implementation in C called libSass. There's also a Java implementation called JSass. Additionally, Vaadin has a Java implementation of Sass. The indented syntax is a metalanguage. SCSS is a nested metalanguage, as valid CSS is valid SCSS with the same semantics. Sass supports integration with the Firefox extension Firebug. SassScript provides the following mechanisms: variables, nesting, mixins, and selector inheritance. | https://en.wikipedia.org/wiki/Sass_(stylesheet_language) |
| Sage | SageMath (previously Sage or SAGE, "System for Algebra and Geometry Experimentation") is a mathematical software with features covering many aspects of mathematics, including algebra, combinatorics, numerical mathematics, number theory, and calculus. The first version of SageMath was released on 24 February 2005 as free and open-source software under the terms of the GNU General Public License version 2, with the initial goals of creating an "open source alternative to Magma, Maple, Mathematica, and MATLAB". The originator and leader of the SageMath project, William Stein, is a mathematician at the University of Washington. SageMath uses a syntax resembling Python's supporting procedural, functional and object-oriented constructs. | https://en.wikipedia.org/wiki/SageMath |
| SYMPL | SYMPL is an obsolete programming language developed by the Control Data Corporation (CDC) for use on the CDC 6000 series computer systems in the 1970s and 1980s. It was based on a subset of CDCs version of JOVIAL, as an alternative to assembly language. A number of important CDC software products were implemented in SYMPL, including compilers, libraries, a full-screen editor, and major subsystems. SYMPL is a compiled, imperative, and procedural language. Compared to the Fortran of the day, SYMPL supports: Stronger data typing - All variables must be declared prior to use, Data structures - Including "based" dynamically allocated structures, Structured programming constructs, Nested procedures, In-fix "bead" (bit) and character manipulation A simple macro facilitySimplifications compared to JOVIAL include: fewer built-in data types, no recursive calls to procedures, and no COMPOOL concept. | https://en.wikipedia.org/wiki/SYMPL |
| SWI Prolog | SWI-Prolog is a free implementation of the programming language Prolog, commonly used for teaching and semantic web applications. It has a rich set of features, libraries for constraint logic programming, multithreading, unit testing, GUI, interfacing to Java, ODBC and others, literate programming, a web server, SGML, RDF, RDFS, developer tools (including an IDE with a GUI debugger and GUI profiler), and extensive documentation. SWI-Prolog runs on Unix, Windows, Macintosh and Linux platforms. SWI-Prolog has been under continuous development since 1987. Its main author is Jan Wielemaker. The name SWI is derived from Sociaal-Wetenschappelijke Informatica ("Social Science Informatics"), the former name of the group at the University of Amsterdam, where Wielemaker is employed. The name of this group has changed to HCS (Human-Computer Studies). | https://en.wikipedia.org/wiki/SWI-Prolog |
| STOS BASIC | STOS BASIC is a dialect of the BASIC programming language implemented on the Atari ST computer. STOS BASIC was originally developed by Jawx, François Lionet, and Constantin Sotiropoulos and published by Mandarin Software (now known as Europress Software). STOS Basic was a version of BASIC that was designed for creating games, but the set of powerful high-level graphics and sound commands it offered made it suitable for developing multimedia-intense software without any knowledge of the internals of the Atari ST. | https://en.wikipedia.org/wiki/STOS_BASIC |
| SR | SR (short for Synchronizing Resources) is a programming language designed for concurrent programming. Resources encapsulate processes and the variables they share, and can be separately compiled. Operations provide the primary mechanism for process interaction. SR provides a novel integration of the mechanisms for invoking and servicing operations. Consequently, it supports local and remote procedure call, rendezvous, message passing, dynamic process creation, multicast, semaphores and shared memory. Version 2.2 has been ported to the Apollo, DECstation, Data General AViiON, HP 9000 Series 300, Multimax, NeXT, PA-RISC, RS/6000, Sequent Symmetry, SGI IRIS, Sun-3, Sun-4 and others. | https://en.wikipedia.org/wiki/SR_%28programming_language%29 |
| Structured Query Reporter | SQR (Hyperion SQR Production Reporting, Part of OBIEE) is a programming language designed for generating reports from database management systems. The name is an acronym of Structured Query Reporter, which suggests its relationship to SQL (Structured Query Language). Any SQL statement can be embedded in an SQR program. | https://en.wikipedia.org/wiki/SQR |
| SQLite | SQLite ( or ) is a relational database management system contained in a C programming library. In contrast to many other database management systems, SQLite is not a client–server database engine. Rather, it is embedded into the end program. SQLite is ACID-compliant and implements most of the SQL standard, using a dynamically and weakly typed SQL syntax that does not guarantee the domain integrity. SQLite is a popular choice as embedded database software for local/client storage in application software such as web browsers. It is arguably the most widely deployed database engine, as it is used today by several widespread browsers, operating systems, and embedded systems (such as mobile phones), among others. SQLite has bindings to many programming languages. | https://en.wikipedia.org/wiki/SQLite |
| SQL/PSM | SQL/PSM (SQL/Persistent Stored Modules) is an ISO standard mainly defining an extension of SQL with a procedural language for use in stored procedures. Initially published in 1996 as an extension of SQL-92 (ISO/IEC 9075-4:1996, a version sometimes called PSM-96 or even SQL-92/PSM), SQL/PSM was later incorporated into the multi-part SQL:1999 standard, and has been part 4 of that standard since then, most recently in SQL:2016. The SQL:1999 part 4 covered less than the original PSM-96 because the SQL statements for defining, managing, and invoking routines were actually incorporated into part 2 SQL/Foundation, leaving only the procedural language itself as SQL/PSM. The SQL/PSM facilities are still optional as far as the SQL standard is concerned; most of them are grouped in Features P001-P008. SQL/PSM standardizes syntax and semantics for control flow, exception handling (called "condition handling" in SQL/PSM), local variables, assignment of expressions to variables and parameters, and (procedural) use of cursors. It also defines an information schema (metadata) for stored procedures. SQL/PSM is one language in which methods for the SQL:1999 structured types can be defined. The other is Java, via SQL/JRT. IBM's SQL PL (used in DB2) and Mimer SQL's PSM were the first two products implementing SQL/PSM. In practice those two, and perhaps also MySQL/MariaDB's procedural language, are closest to the SQL/PSM standard. SQL/PSM resembles and is inspired by PL/SQL, as well as PL/pgSQL, so they are similar languages. With PostgreSQL v9 some SQL/PSM features, like overloading of SQL-invoked functions and procedures are now supported. A PostgreSQL addon implements SQL/PSM (alongside its own procedural language), although it is not part of the core product.RDF functionality in OpenLink Virtuoso was developed entirely through SQL/PSM, combined with custom datatypes (e.g., ANY for handling URI and Literal relation objects), sophisticated indexing, and flexible physical storage choices (column-wise or row-wise). | https://en.wikipedia.org/wiki/SQL/PSM |
| SQL-92 | SQL-92 was the third revision of the SQL database query language. Unlike SQL-89, it was a major revision of the standard. Aside from a few minor incompatibilities, the SQL-89 standard is forward-compatible with SQL-92. The standard specification itself grew about five times compared to SQL-89. Much of it was due to more precise specifications of existing features; the increase due to new features was only by a factor of 1.5–2. Many of the new features had already been implemented by vendors before the new standard was adopted. However, most of the new features were added to the "intermediate" and "full" tiers of the specification, meaning that conformance with SQL-92 entry level was scarcely any more demanding than conformance with SQL-89. Later revisions of the standard include SQL:1999 (SQL3), SQL:2003, SQL:2008, SQL:2011 and SQL:2016. | https://en.wikipedia.org/wiki/SQL-92 |
| SQLPL | SQL PL stands for Structured Query Language Procedural Language and was developed by IBM as a set of commands that extend the use of SQL in the IBM DB2 (DB2 UDB Version 7) database system. It provides procedural programmability in addition to the querying commands of SQL. It is a subset of the SQL Persistent Stored Modules (SQL/PSM) language standard. As of DB2 version 9, SQL PL stored procedures can run natively inside the DB2 process (inside the DBM1 address space, more precisely) instead of being fenced in an external process. In DB2 version 9.7 IBM also added a PL/SQL front-end to this infrastructure (called "SQL Unified Runtime Engine"), meaning that procedural SQL using either the ISO standard or Oracle's syntax compile to bytecode running on the same engine in DB2. | https://en.wikipedia.org/wiki/SQL_PL |
| SQL | SQL ( ( listen) ESS-kew-EL or ( listen) SEE-kwəl or SKWEEL, Structured Query Language) is a domain-specific language used in programming and designed for managing data held in a relational database management system (RDBMS), or for stream processing in a relational data stream management system (RDSMS). In comparison to older read/write APIs like ISAM or VSAM, SQL offers two main advantages: first, it introduced the concept of accessing many records with one single command; and second, it eliminates the need to specify how to reach a record, e.g. with or without an index. Originally based upon relational algebra and tuple relational calculus, SQL consists of a data definition language, data manipulation language, and data control language. The scope of SQL includes data insert, query, update and delete, schema creation and modification, and data access control. Although SQL is often described as, and to a great extent is, a declarative language (4GL), it also includes procedural elements. SQL was one of the first commercial languages for Edgar F. Codd's relational model, as described in his influential 1970 paper, "A Relational Model of Data for Large Shared Data Banks". Despite not entirely adhering to the relational model as described by Codd, it became the most widely used database language. SQL became a standard of the American National Standards Institute (ANSI) in 1986, and of the International Organization for Standardization (ISO) in 1987. Since then, the standard has been revised to include a larger set of features. Despite the existence of such standards, most SQL code is not completely portable among different database systems without adjustments. | https://en.wikipedia.org/wiki/SQL |
| IBM Rational SQABasic | SQABasic is the Rational Software Corporation language for building GUI scripts. It is an integral part of IBM Rational Robot, a tool used for developing regression tests. | https://en.wikipedia.org/wiki/IBM_Rational_SQABasic |
| SPSS | SPSS Statistics is a software package used for logical batched and non-batched statistical analysis. Long produced by SPSS Inc., it was acquired by IBM in 2009. The current versions (2015) are officially named IBM SPSS Statistics. Companion products in the same family are used for survey authoring and deployment (IBM SPSS Data Collection, now divested under UNICOM Intelligence), data mining (IBM SPSS Modeler), text analytics, and collaboration and deployment (batch and automated scoring services). The software name originally stood for Statistical Package for the Social Sciences (SPSS), reflecting the original market, although the software is now popular in other fields as well, including the health sciences and marketing. | https://en.wikipedia.org/wiki/SPSS |
| SPITBOL | SPITBOL (Speedy Implementation of SNOBOL) is a compiled implementation of the SNOBOL4 programming language. Originally targeted for the IBM System/360 and System/370 family of computers, it has now been ported to most major microprocessors including the SPARC. It was created by Robert Dewar and Ken Belcher, who were then at the Illinois Institute of Technology. Prior to the development of SPITBOL, SNOBOL4 was thought to be slow, memory-intensive, and impossible to compile due to its dynamic nature. While delayed binding prevents everything from being determined at compile time, SPITBOL adopts various strategies for making decisions as early as possible. Recent versions of the SPITBOL compiler are available. Since 2001 the source code for the original SPITBOL 360 compiler has been made available under the GNU General Public License. MACRO SPITBOL is an implementation of SPITBOL written in the 1970s by Robert Dewar and Anthony P. McCann. MACRO SPITBOL is coded in MINIMAL, an assembly language for an abstract machine. The instruction set is carefully defined to allow some latitude in its implementation, so that hardware operations favorable to string processing can be exploited. An implementation of MINIMAL that was designed for interpretation on microcomputers was done by translating MINIMAL into MICRAL using a translator that was itself implemented in SPITBOL. The MICRAL version of MACRO SPITBOL, together with the MICRAL interpreter ran in under 40K bytes. This extreme object code compression of MICRAL is achieved using a set of machine code macro substitutions that minimizes the space required for the object code and macro table. The complexity of known algorithms for an optimal solution to this problem are high, but efficient heuristics attain near-optimal results. The source code for MACRO SPITBOL was released under the GNU General Public License on April 17, 2009. | https://en.wikipedia.org/wiki/SPITBOL |
| SPIP | SPIP (Système de Publication pour l'Internet) is a free software content management system designed for web site publishing, oriented towards online collaborative editing. The software is designed for easy setup, use and maintenance, and is used in public and private institutions. The last P in the word SPIP stands for both Partagé (shared) and Participatif (participative), in the sense that the software is designed for collective online editing. Its mascot is a flying squirrel. It is used both by institutional sites, community portals, academic sites, personal webpages, and news sites. | https://en.wikipedia.org/wiki/SPIP |
| SPARQL | SPARQL (pronounced "sparkle", a recursive acronym for SPARQL Protocol and RDF Query Language) is an RDF query language, that is, a semantic query language for databases, able to retrieve and manipulate data stored in Resource Description Framework (RDF) format. It was made a standard by the RDF Data Access Working Group (DAWG) of the World Wide Web Consortium, and is recognized as one of the key technologies of the semantic web. On 15 January 2008, SPARQL 1.0 became an official W3C Recommendation, and SPARQL 1.1 in March, 2013. SPARQL allows for a query to consist of triple patterns, conjunctions, disjunctions, and optional patterns. Implementations for multiple programming languages exist. There exist tools that allow one to connect and semi-automatically construct a SPARQL query for a SPARQL endpoint, for example ViziQuer. In addition, there exist tools that translate SPARQL queries to other query languages, for example to SQL and to XQuery. | https://en.wikipedia.org/wiki/SPARQL |
| SPARK | SPARK is a formally defined computer programming language based on the Ada programming language, intended for the development of high integrity software used in systems where predictable and highly reliable operation is essential. It facilitates the development of applications that demand safety, security, or business integrity. Originally, there were three versions of the SPARK language (SPARK83, SPARK95, SPARK2005) based on Ada 83, Ada 95 and Ada 2005 respectively. A fourth version of the SPARK language, SPARK 2014, based on Ada 2012, was released on April 30, 2014. SPARK 2014 is a complete re-design of the language and supporting verification tools. The SPARK language consists of a well-defined subset of the Ada language that uses contracts to describe the specification of components in a form that is suitable for both static and dynamic verification. In SPARK83/95/2005, the contracts are encoded in Ada comments (and so are ignored by any standard Ada compiler), but are processed by the SPARK "Examiner" and its associated tools. SPARK 2014, in contrast, uses Ada 2012's built-in "aspect" syntax to express contracts, bringing them into the core of the language. The main tool for SPARK 2014 (GNATprove) is based on the GNAT/GCC infrastructure, and re-uses almost the entirety of the GNAT Ada 2012 front-end. | https://en.wikipedia.org/wiki/SPARK_(programming_language) |
| SPARC | SPARC, for Scalable Processor Architecture, is a reduced instruction set computing (RISC) instruction set architecture (ISA) originally developed by Sun Microsystems. Its design was strongly influenced by the experimental Berkeley RISC system developed in the early 1980s. First released in 1987, SPARC was one of the most successful early commercial RISC systems, and its success led to the introduction of similar RISC designs from a number of vendors through the 1980s and 90s. The first implementation of the original 32-bit architecture (SPARC V7) was used in Sun's Sun-4 workstation and server systems, replacing their earlier Sun-3 systems based on the Motorola 68000 series of processors. SPARC V8 added a number of improvements that were part of the SuperSPARC series of processors released in 1992. SPARC V9, released in 1993, introduced a 64-bit architecture and was first released in Sun's UltraSPARC processors in 1995. Later, SPARC processors were used in SMP and CC-NUMA servers produced by Sun, Solbourne and Fujitsu, among others. The design was turned over to the SPARC International trade group in 1989, and since then its architecture has been developed by its members. SPARC International is also responsible for licensing and promoting the SPARC architecture, managing SPARC trademarks (including SPARC, which it owns), and providing conformance testing. SPARC International was intended to grow the SPARC architecture to create a larger ecosystem; SPARC has been licensed to several manufacturers, including Atmel, Bipolar Integrated Technology, Cypress Semiconductor, Fujitsu, Matsushita and Texas Instruments. Due to SPARC International, SPARC is fully open, non-proprietary and royalty-free. By September 2017, the latest commercial high-end SPARC processors are Fujitsu's SPARC64 XII (introduced in 2017 for its SPARC M12 server) and SPARC64 XIfx (introduced in 2015 for its PRIMEHPC FX100 supercomputer); and Oracle's SPARC M8 (introduced in September 2017 for its high-end servers). On Friday, September 1, 2017, after a round of layoffs that started in Oracle Labs in November of 2016, Oracle finally killed off SPARC design after the completion of the M8. Nearly the entire processor core development group in Austin was let go, and the same for the SOC teams in California and Burlington. | https://en.wikipedia.org/wiki/SPARC |
| SP/k | SP/k is a programming language developed circa 1974 by R.C. Holt, D.B. Wortman, D.T. Barnard and J.R. Cordy as a subset of the PL/I programming language designed for teaching programming. It was used for about a decade at over 40 universities, schools, and research laboratories in Canada and the United States. SP/k was one of the first languages specifically designed to encourage structured programming. The features of SP/k were chosen to encourage structured problem solving by computers, to make the language easy to learn and use, to eliminate confusing and redundant constructs, and to make the language easy to compile.The resulting language was suitable for introducing programming concepts used in various applications, including business data processing, scientific calculations and non-numeric computation. SP/k is actually a sequence of language subsets called SP/1, SP/2, … SP/8. Each subset introduces new programming language constructs while retaining all the constructs of preceding subsets, forming a stepwise system for teaching computer programming. Each subset is precisely defined and self-contained, and can be learned or implemented without the following subsets. This allows for various levels of programming education. The design and philosophy of SP/k was a strong influence on the Turing programming language. | https://en.wikipedia.org/wiki/SP/k |
| SOAP | SOAP (originally Simple Object Access Protocol) is a protocol specification for exchanging structured information in the implementation of web services in computer networks. Its purpose is to induce extensibility, neutrality and independence. It uses XML Information Set for its message format, and relies on application layer protocols, most often Hypertext Transfer Protocol (HTTP) or Simple Mail Transfer Protocol (SMTP), for message negotiation and transmission. SOAP allows processes running on disparate operating systems (such as Windows and Linux) to communicate using Extensible Markup Language (XML). Since Web protocols like HTTP are installed and running on all operating systems, SOAP allows clients to invoke web services and receive responses independent of language and platforms. | https://en.wikipedia.org/wiki/SOAP |
| SNOBOL | SNOBOL (StriNg Oriented and symBOlic Language) is a series of computer programming languages developed between 1962 and 1967 at AT&T Bell Laboratories by David J. Farber, Ralph E. Griswold and Ivan P. Polonsky, culminating in SNOBOL4. It was one of a number of text-string-oriented languages developed during the 1950s and 1960s; others included COMIT and TRAC. SNOBOL4 stands apart from most programming languages of its era by having patterns as a first-class data type (i.e. a data type whose values can be manipulated in all ways permitted to any other data type in the programming language) and by providing operators for pattern concatenation and alternation. In later object-oriented languages, such as JavaScript, patterns are a type of object, and admit various manipulations. Further, strings generated during execution can be treated as programs and executed (as in the eval function of other languages). SNOBOL4 was quite widely taught in larger US universities in the late 1960s and early 1970s and was widely used in the 1970s and 1980s as a text manipulation language in the humanities. In the 1980s and 1990s its use faded as newer languages such as AWK and Perl made string manipulation by means of regular expressions fashionable. SNOBOL4 patterns subsume BNF grammars, which are equivalent to context-free grammars and more powerful than regular expressions. The "regular expressions" in current versions of AWK and Perl are in fact extensions of regular expressions in the traditional sense, but regular expressions, unlike SNOBOL4 patterns, are not recursive, which gives a distinct computational advantage to SNOBOL4 patterns. (Recursive expressions did appear in Perl 5.10, though, released in December 2007.) One of the designers of SNOBOL, Ralph Griswold, designed successors to SNOBOL4 called SL5 and Icon, which combined the backtracking of SNOBOL4 pattern matching with more standard ALGOL-like structuring, as well as adding some features of their own. | https://en.wikipedia.org/wiki/SNOBOL |
| SMX | SMX (from Server Macro Expansion) is a macro processing language designed to embed macros in web pages. Originally shipped with the popular Internet Factory's Commerce Builder software, it has been ported as an Apache module. | https://en.wikipedia.org/wiki/SMX_%28computer_language%29 |
| SMILES arbitrary target specification | SMILES arbitrary target specification (SMARTS) is a language for specifying substructural patterns in molecules. The SMARTS line notation is expressive and allows extremely precise and transparent substructural specification and atom typing. SMARTS is related to the SMILES line notation that is used to encode molecular structures and like SMILES was originally developed by David Weininger and colleagues at Daylight Chemical Information Systems. The most comprehensive descriptions of the SMARTS language can be found in Daylight's SMARTS theory manual, tutorial and examples. OpenEye Scientific Software has developed their own version of SMARTS which differs from the original Daylight version in how the R descriptor (see cyclicity below) is defined. | https://en.wikipedia.org/wiki/SMILES_arbitrary_target_specification |
| Small | SMALL, Small Machine Algol Like Language, is a programming language developed by Dr. Nevil Brownlee of Auckland University. | https://en.wikipedia.org/wiki/SMALL |
| SLIP | SLIP is a list processing computer programming language, invented by Joseph Weizenbaum in the 1960s. The name SLIP stands for Symmetric LIst Processor. It was first implemented as an extension to the Fortran programming language, and later embedded into MAD and ALGOL. | https://en.wikipedia.org/wiki/SLIP_(programming_language) |
| Cadence SKILL | SKILL is a Lisp dialect used as a scripting language and PCell (parameterized cells) description language used in many EDA software suites by Cadence Design Systems. It was originally put forth in an IEEE paper in 1990. | https://en.wikipedia.org/wiki/Cadence_SKILL |
| SISC | SISC is an R5RS Scheme implementation, which includes a full number tower, hygienic macros, proper tail recursion, and first class continuations. SISC is short for Second Interpreter of Scheme Code, in reference to its predecessor LISC, the Lightweight Interpreter of Scheme Code.SISC is free software, dual-licensed under the Mozilla Public License and the GNU General Public License, Version 2. It was developed by Scott G. Miller and Matthias Radestock. | https://en.wikipedia.org/wiki/SISC |
| SISAL | SISAL ("Streams and Iteration in a Single Assignment Language") is a general-purpose single assignment functional programming language with strict semantics, implicit parallelism, and efficient array handling. SISAL outputs a dataflow graph in Intermediary Form 1 (IF1). It was derived from VAL (Value-oriented Algorithmic Language, designed by Jack Dennis), and adds recursion and finite streams. It has a Pascal-like syntax and was designed to be a common high-level language for numerical programs on a variety of multiprocessors. | https://en.wikipedia.org/wiki/SISAL |
| SIMSCRIPT | SIMSCRIPT is a free-form, English-like general-purpose simulation language conceived by Harry Markowitz and Bernard Hausner at the RAND Corporation in 1963. It was implemented as a Fortran preprocessor on the IBM 7090 and was designed for large discrete event simulations. It influenced Simula. Though earlier versions were released into the public domain, SIMSCRIPT was commercialized by Markowitz's company, California Analysis Center, Inc., which produced proprietary versions SIMSCRIPT I.5 and SIMSCRIPT II.5. | https://en.wikipedia.org/wiki/SIMSCRIPT |
| SIMPLE | SIMPLE may refer to: | https://en.wikipedia.org/wiki/SIMPLE |
| SIGNAL | SIGNAL is a programming language based on synchronized data-flow (flows + synchronization): a process is a set of equations on elementary flows describing both data and control. The SIGNAL formal model provides the capability to describe systems with several clocks (polychronous systems) as relational specifications. Relations are useful as partial specifications and as specifications of non-deterministic devices (for instance a non-deterministic bus) or external processes (for instance an unsafe car driver). Using SIGNAL allows one to specify an application, to design an architecture, to refine detailed components down to RTOS or hardware description. The SIGNAL model supports a design methodology which goes from specification to implementation, from abstraction to concretization, from synchrony to asynchrony. SIGNAL has been mainly developed in INRIAEspresso team since the 1980s, at the same time as similar programming languages, Esterel and Lustre. | https://en.wikipedia.org/wiki/SIGNAL_(programming_language) |
| SHA-3 | SHA-3 (Secure Hash Algorithm 3) is the latest member of the Secure Hash Algorithm family of standards, released by NIST on August 5, 2015. Although part of the same series of standards, SHA-3 is internally different from the MD5-like structure of SHA-1 and SHA-2. SHA-3 is a subset of the broader cryptographic primitive family Keccak (), designed by Guido Bertoni, Joan Daemen, Michaël Peeters, and Gilles Van Assche, building upon RadioGatún. Keccak's authors have proposed additional uses for the function, not (yet) standardized by NIST, including a stream cipher, an authenticated encryption system, a "tree" hashing scheme for faster hashing on certain architectures, and AEAD ciphers Keyak and Ketje.Keccak is based on a novel approach called sponge construction. Sponge construction is based on a wide random function or random permutation, and allows inputting ("absorbing" in sponge terminology) any amount of data, and outputting ("squeezing") any amount of data, while acting as a pseudorandom function with regard to all previous inputs. This leads to great flexibility. NIST does not currently plan to withdraw SHA-2 or remove it from the revised Secure Hash Standard. The purpose of SHA-3 is that it can be directly substituted for SHA-2 in current applications if necessary, and to significantly improve the robustness of NIST's overall hash algorithm toolkit.The creators of the Keccak algorithms and the SHA-3 functions suggest using the faster function KangarooTwelve with adjusted parameters and a new tree hashing mode without extra overhead for small message sizes. | https://en.wikipedia.org/wiki/SHA-3 |
| SHA-2 | SHA-2 (Secure Hash Algorithm 2) is a set of cryptographic hash functions designed by the United States National Security Agency (NSA). They are built using the Merkle–Damgård structure, from a one-way compression function itself built using the Davies–Meyer structure from a (classified) specialized block cipher. SHA-2 includes significant changes from its predecessor, SHA-1. The SHA-2 family consists of six hash functions with digests (hash values) that are 224, 256, 384 or 512 bits: SHA-224, SHA-256, SHA-384, SHA-512, SHA-512/224, SHA-512/256. SHA-256 and SHA-512 are novel hash functions computed with 32-bit and 64-bit words, respectively. They use different shift amounts and additive constants, but their structures are otherwise virtually identical, differing only in the number of rounds. SHA-224 and SHA-384 are truncated versions of SHA-256 and SHA-512 respectively, computed with different initial values. SHA-512/224 and SHA-512/256 are also truncated versions of SHA-512, but the initial values are generated using the method described in Federal Information Processing Standards (FIPS) PUB 180-4. SHA-2 was published in 2001 by the National Institute of Standards and Technology (NIST) a U.S. federal standard (FIPS). The SHA-2 family of algorithms are patented in US patent 6829355. The United States has released the patent under a royalty-free license.Currently, the best public attacks break preimage resistance for 52 out of 64 rounds of SHA-256 or 57 out of 80 rounds of SHA-512, and collision resistance for 46 out of 64 rounds of SHA-256. | https://en.wikipedia.org/wiki/SHA-2 |
| SETL | SETL (SET Language) is a very high-level programming language based on the mathematical theory of sets. It was originally developed by (Jack) Jacob T. Schwartz at the New York University (NYU) Courant Institute of Mathematical Sciences in the late 1960s. | https://en.wikipedia.org/wiki/SETL |
| ISETL | SETL (SET Language) is a very high-level programming language based on the mathematical theory of sets. It was originally developed by (Jack) Jacob T. Schwartz at the New York University (NYU) Courant Institute of Mathematical Sciences in the late 1960s. | https://en.wikipedia.org/wiki/ISETL_%28programming_language%29 |
| SDTM | SDTM (Study Data Tabulation Model) defines a standard structure for human clinical trial (study) data tabulations and for nonclinical study data tabulations that are to be submitted as part of a product application to a regulatory authority such as the United States Food and Drug Administration (FDA). The Submission Data Standards team of Clinical Data Interchange Standards Consortium (CDISC) defines SDTM. On July 21, 2004, SDTM was selected as the standard specification for submitting tabulation data to the FDA for clinical trials and on July 5, 2011 for nonclinical studies. Eventually, all data submissions will be expected to conform to this format. As a result, clinical and nonclinical Data Managers will need to become proficient in the SDTM to prepare submissions and apply the SDTM structures, where appropriate, for operational data management. | https://en.wikipedia.org/wiki/SDTM |
| SDF | SDF may refer to: | https://en.wikipedia.org/wiki/SDF |
| SCRIPT markup | SCRIPT, any of a series of text markup languages starting with Script under Control Program-67/Cambridge Monitor System (CP-67/CMS) and Script/370 under Virtual Machine Facility/370 (VM/370); the current version, SCRIPT/VS, is part of IBM's Document Composition Facility (DCF) for IBM z/VM and z/OS systems. SCRIPT was developed for CP-67/CMS by Stuart Madnick at MIT, succeeding CTSS RUNOFF. SCRIPT is a procedural markup language. Inline commands called control words, indicated by a period in the first column of a logical line, describe the desired appearance of the formatted text. SCRIPT originally provided a 2PASS option to allow text to refer to variables defined later in the text, but subsequent versions allowed more than two passes. | https://en.wikipedia.org/wiki/SCRIPT_(markup) |
| SCM | SCM is a programming language, a dialect of the language Scheme. It is written in the language C, by Aubrey Jaffer, the author of the SLIB Scheme library and the JACAL interactive computer algebra (symbolic mathematics) program. It conforms to the standards R4RS, R5RS, and IEEE P1178. It is free and open-source software released under a GNU Lesser General Public License (LGPL).SCM runs on many different operating systems such as AmigaOS (also emulation), Linux, Atari-ST, macOS (SCM Mac), DOS, OS/2, NOS/VE, Unicos, VMS, Unix, and similar systems. SCM includes Hobbit, a Scheme-to-C compiler written originally in 2002 by Tanel Tammet. It generates C files which binaries can be dynamically or statically linked with an SCM executable. SCM includes linkable modules for SLIB features like sequence comparison, arrays, records, and byte-number conversions, and modules for Portable Operating System Interface (POSIX) system calls and network sockets, Readline, curses, and Xlib. On some platforms, SCM supports unexec (developed for Emacs and bash), which dumps an executable image from a running SCM. This results in a fast startup for SCM. SCM developed from Scheme In One Defun (SIOD) in about 1990. GNU Guile developed from SCM in 1993. | https://en.wikipedia.org/wiki/SCM_(Scheme_implementation) |
| SASL | SASL (from St Andrews Static Language, alternatively St Andrews Standard Language) is a purely functional programming language developed by David Turner at the University of St Andrews in 1972, based on the applicative subset of ISWIM. In 1976 Turner redesigned and reimplemented it as a non-strict (lazy) language. In this form it was the foundation of Turner's later languages KRC and Miranda, but SASL appears to be untyped whereas Miranda has polymorphic types. Burroughs Corporation used SASL to write a compiler and operating system. | https://en.wikipedia.org/wiki/SASL_%28programming_language%29 |
| SAM76 | SAM76 is a macro programming language used from the late 1970s to the present 2007 initially ran on CP/M. The SAM76 language is a list and string processor designed for interactive and user-directed applications, including artificial intelligence programming, and permits high portability from machine to machine. The language shares certain features in common with LISP, Forth, and shell programming languages of the UNIX operating system. Claude A. R. Kagan, the language's developer, sought to combine within a single interpretive processor, the characteristics of two different string and general-purpose macro generators and the provisions to embed multiple infix operator mathematical systems. SAM76 was designed to: be very pure syntactically and semantically; require a minimum of user keyboarding to achieve powerful results; fit in a very small computer system; permit editing, testing, and executing modules interactively; not prevent the user from doing strange things with the syntax of the language yielding, however, predictable results. The language was based around the idea of programming with macros. A user will define a macro (a code word that can be defined by the user to invoke a specific set of instructions to perform a routine within the program) to execute a set of instructions, usually in either machine or assembly language, and use the macro in the program. In this way, a user need only define a routine once and then when that particular operation, or string is required, the user can substitute is with the macro name. Since then the language has been rewritten in C and compiles on Windows, Unix, Linux, and similar operating systems. The source code is available online and still compiles and runs as of 2006. | https://web.archive.org/web/20160203211054/https://en.wikipedia.org/wiki/SAM76 |
| System Automatycznego Kodowania Operacji | SAKO (PL: System Automatycznego Kodowania Operacji - EN: Automatic Operation Encoding System) is a non-English-based programming language written for Polish computers XYZ, ZAM-2, ZAM-21 and ZAM-41. | https://en.wikipedia.org/wiki/SAKO_(programming_language) |
| SAC | SAC (Single Assignment C) is a strict purely functional programming language whose design is focused on the needs of numerical applications. Emphasis is laid on efficient support for array processing. Efficiency concerns are essentially twofold. On the one hand, efficiency in program development is to be improved by the opportunity to specify array operations on a high level of abstraction. On the other hand, efficiency in program execution, i.e. the runtime performance of programs, in time and memory consumption, is still to be achieved by sophisticated compilation schemes. Only as far as the latter succeeds, the high-level style of specifications can actually be called useful. To facilitate compiling to efficiently executable code, certain functional language features which are not considered essential for numerical applications, e.g. higher-order functions, polymorphism, or lazy evaluation, are not (yet) supported by SAC. These may be found in general-purpose functional languages, e.g. Haskell, Clean, Miranda, or ML. To overcome the acceptance problems encountered by other functional or array based languages intended for numerical / array intensive applications, e.g. SISAL, NESL, Nial, APL, J, or K, particular regard is paid to ease the transition from a C / Fortran like programming environment to SAC. In more detail, the basic language design goals of SAC are to: provide a purely functional language with a syntax very similar to that of C in order to ease, for a large community of programmers, the transition from an imperative to a functional programming style; support multi-dimensional arrays as first class objects; allow the specification of shape- and dimension-invariant array operations; provide high-level array operations that liberate programming from tedious and error-prone specifications of starts, stops and strides for array traversals thereby improving code reusability and programming productivity, in general. incorporate a module system that allows for separate compilation, separate name spaces, and abstract data types, and, additionally, provides an interface to foreign languages in order to enable reuse of existing code; provide means for a smooth integration of states and state modifications into the functional paradigm based on uniqueness types; use the module system, the foreign language interface, and the integration of states in order to create a standard library which provides a functionality similar to that of the standard C libraries, e.g. powerful I/O facilities or mathematical functions; facilitate the compilation to host machine code which can be efficiently executed both in terms of time and space demand; facilitate the compilation for non-sequential program execution in multiprocessor environments. | https://en.wikipedia.org/wiki/SAC_programming_language |
| S3 | S3 is a structured, imperative high-level computer programming language. It was developed by the UK company International Computers Limited (ICL) for its 2900 Series mainframes. It is a system programming language with syntax influenced by ALGOL 68 but with data types and operators aligned to those offered by the 2900 Series. It was the implementation language of the operating system VME. | https://en.wikipedia.org/wiki/S3_(programming_language) |
| System 2 | S2 (Style System 2) is an object-oriented programming language developed in the late 1990s by Brad Fitzpatrick, Martin "Mart" Atkins, and others for the online journaling service LiveJournal in order to allow users full control over the appearance of their pages. S2 source code is compiled into Perl, which the webserver can then execute directly for individual web page requests. The S2 system is, at its heart, completely general and can be used for almost any web application; however there exists no documentation for the implementation of S2 within other applications, which ties it relatively closely to LiveJournal. This article will make use of LiveJournal's implementation of S2 for examples. A link to detailed documentation about this implementation can be found at the bottom. | https://en.wikipedia.org/wiki/S2_(programming_language) |
| S-algol | S-algol (St Andrews Algol) is a computer programming language derivative of ALGOL 60 developed at the University of St Andrews in 1979 by Ron Morrison and Tony Davie. The language is a modification of ALGOL to contain orthogonal data types that Morrison created for his PhD thesis. Morrison would go on to become professor at the university and head of the department of computer science. The S-algol language was used for teaching at the university at an undergraduate level until 1999. It was also the language taught for several years in the 1980s at a local school in St. Andrews, Madras College. The computer science text Recursive Descent Compiling describes a recursive descent compiler for S-algol, using S-algol as the implementation language. PS-algol is a persistent derivative of S-algol. It was developed around 1981 at the Universities of Edinburgh and St Andrews. It supports database capability by providing for longevity of data in the form of a persistent heap that survives termination of PS-algol programs. | https://en.wikipedia.org/wiki/S-algol |
| S-PLUS | S-PLUS is a commercial implementation of the S programming language sold by TIBCO Software Inc.. It features object-oriented programming capabilities and advanced analytical algorithms. | https://en.wikipedia.org/wiki/S-PLUS |
| SBASIC | S-BASIC (for Structured Basic) was a "structured" BASIC variant, distributed with Kaypro CP/M systems. It was made by Topaz Programming is distributed by Micro-Ap (San Ramon, CA).SBasic was compatible with the syntax of Basic, a programming language commonly used in the 1970s through the 1980s, as well as Fortran77. However, the language relaxed many of the requirements of Basic and had more flexibility than Fortran. For instance, line numbers were optional, and permitted non-numeric characters. In addition, SBasic offered developers structured programming concepts, including recursion and nesting. Many PL-1 programs could be compiled with little modification, though SBasic did not offer an extensive function library. Among the more advanced features was the ability to "base" a variable or array, making the memory location dynamic and modifiable during execution. SBasic programs had the ability to access memory areas reserved for the operating system unless prohibited from doing so by the operating system itself. (Kaypro's CP/M had no such prohibitions.) This enabled direct utilization and modification of DMA and other memory areas. This feature also permitted a program to modify itself at run-time. This capability also allowed modifying the instruction pointer, so a program could effectively link other executable modules that were read during execution as data. Unlike Basic interpreters that stored "p-code" that was parsed by an execution module, SBasic was a two-pass compiler, ultimately producing .com files that were executable. The language was written in a subset of itself and compiled using a .com kernel, then stored on diskette (or hard drive on the last KayPro model). The source was distributed with some KayPro models. This encouraged open-source-like modification of the language, with some early pre-Internet user groups exchanging physical diskettes by regular mail. Not to be confused with the namesake SBasic (S for Spectral Basic) Programming Language for the commercial Spectral UV-Visible software. | https://en.wikipedia.org/wiki/SBASIC |
| S | S is a statistical programming language developed primarily by John Chambers and (in earlier versions) Rick Becker and Allan Wilks of Bell Laboratories. The aim of the language, as expressed by John Chambers, is "to turn ideas into software, quickly and faithfully". The modern implementations of S is R, a part of the GNU free software project. S-PLUS, a commercial product, was formally sold by TIBCO Software. | https://en.wikipedia.org/wiki/S_(programming_language) |
| Rust | Rust is a systems programming language sponsored by Mozilla Research, which describes it as a "safe, concurrent, practical language," supporting functional and imperative-procedural paradigms. Rust is syntactically similar to C++, but its designers intend it to provide better memory safety while maintaining performance. Rust is an open source programming language. Its designers have refined the language through the experiences of writing the Servo web browser layout engine and the Rust compiler. A large portion of current commits to the project are from community members. Rust won first place for "most loved programming language" in the Stack Overflow Developer Survey in 2016 and 2017; it is referenced in The Book of Mozilla as "oxidised metal". | https://en.wikipedia.org/wiki/Rust_(programming_language) |
| Run BASIC | Run BASIC is a web application server, based on the Liberty BASIC version of the BASIC programming language. | https://en.wikipedia.org/wiki/Run_BASIC |
| RuleML | RuleML is a global initiative, led by a non-profit organization RuleML Inc., that is devoted to advancing research and industry standards design activities in the technical area of rules that are semantic and highly inter-operable. The standards design takes the form primarily of a markup language, also known as RuleML. The research activities include an annual research conference, the RuleML Symposium, also known as RuleML for short. Founded in fall 2000 by Harold Boley, Benjamin Grosof, and Said Tabet, RuleML was originally devoted purely to standards design, but then quickly branched out into the related activities of coordinating research and organizing an annual research conference starting in 2002. The M in RuleML is sometimes interpreted as standing for Markup and Modeling. The markup language was developed to express both forward (bottom-up) and backward (top-down) rules in XML for deduction, rewriting, and further inferential-transformational tasks. It is defined by the Rule Markup Initiative, an open network of individuals and groups from both industry and academia that was formed to develop a canonical Web language for rules using XML markup and transformations from and to other rule standards/systems. Markup standards and initiatives related to RuleML include: Rule Interchange Format (RIF): The design and overall purpose of W3C's Rule Interchange Format (RIF) industry standard is based primarily on the RuleML industry standards design. Like RuleML, RIF embraces a multiplicity of potentially useful rule dialects that nevertheless share common characteristics. RuleML Technical Committee from Oasis-Open: An industry standards effort devoted to legal automation utilizing RuleML. Semantic Web Rule Language (SWRL): An industry standards design, based primarily on an early version of RuleML, whose development was funded in part by the DARPA Agent Markup Language (DAML) research program. Semantic Web Services Framework], particularly its Semantic Web Services Language: An industry standards design, based primarily on a medium-mature version of RuleML, whose development was funded in part by the DARPA Agent Markup Language (DAML) research program and the WSMO research effort of the EU. Mathematical Markup Language (MathML): However, MathML's Content Markup is better suited for defining functions rather than relations or general rules Predictive Model Markup Language (PMML): With this XML-based language one can define and share various models for data-mining results, including association rules Attribute Grammars in XML (AG-markup): For AG's semantic rules, there are various possible XML markups that are similar to Horn-rule markup Extensible Stylesheet Language Transformations (XSLT): This is a restricted term-rewriting system of rules, written in XML, for transforming XML documents into other text documents | https://en.wikipedia.org/wiki/RuleML |
| RubyGems | RubyGems is a package manager for the Ruby programming language that provides a standard format for distributing Ruby programs and libraries (in a self-contained format called a "gem"), a tool designed to easily manage the installation of gems, and a server for distributing them. It was created by Chad Fowler and Richard Kilmer during RubyConf 2004.The interface for RubyGems is a command-line tool called gem which can install and manage libraries (the gems). RubyGems integrates with Ruby run-time loader to help find and load installed gems from standardized library folders. Though it is possible to use a private RubyGems repository, the public repository is most commonly used for gem management. The public repository helps users find gems, resolve dependencies and install them. RubyGems is bundled with the standard Ruby package as of Ruby 1.9. | https://en.wikipedia.org/wiki/RubyGems |
| Ruby on Rails | Ruby on Rails, or Rails, is a server-side web application framework written in Ruby under the MIT License. Rails is a model–view–controller (MVC) framework, providing default structures for a database, a web service, and web pages. It encourages and facilitates the use of web standards such as JSON or XML for data transfer, and HTML, CSS and JavaScript for display and user interfacing. In addition to MVC, Rails emphasizes the use of other well-known software engineering patterns and paradigms, including convention over configuration (CoC), don't repeat yourself (DRY), and the active record pattern. | https://en.wikipedia.org/wiki/Ruby_on_Rails |
| Ruby | Ruby is a dynamic, reflective, object-oriented, general-purpose programming language. It was designed and developed in the mid-1990s by Yukihiro "Matz" Matsumoto in Japan. According to its creator, Ruby was influenced by Perl, Smalltalk, Eiffel, Ada, and Lisp. It supports multiple programming paradigms, including functional, object-oriented, and imperative. It also has a dynamic type system and automatic memory management. | https://en.wikipedia.org/wiki/Ruby_(programming_language) |
| Rosetta-2 | Rosetta is a dynamic binary translator developed by Apple Inc. for macOS, an application compatibility layer between different instruction set architectures. It enables a transition to newer hardware, by automatically translating software. The name is a reference to the Rosetta Stone, the artifact which enabled translation of Egyptian hieroglyphs. The first version of Rosetta, introduced in 2006 in Mac OS X Tiger, was part of the Mac transition from PowerPC processors to Intel processors, allowing PowerPC applications to run on Intel-based Macs. The second version, introduced in 2020 as a component of macOS Big Sur, is part of the Mac transition from Intel processors to Apple silicon, allowing Intel applications to run on Apple silicon Macs. | https://en.wikipedia.org/wiki/Rosetta_(software) |
| IpTables Rope | Rope is a programming language that allows developers to write extensions to the Iptables/Netfilter components of Linux using a simple scripting language based on Reverse Polish notation. It is a scriptable Iptables match module, used to identify whether IP packets passed to it match a particular set of criteria or not. Rope started life as a project to make the "string" match module of Iptables stronger and evolved fairly quickly into an open-ended scriptable packet matching mechanism. | https://en.wikipedia.org/wiki/IpTables_Rope |
| Rocky Mountain BASIC | Rocky Mountain BASIC (also RMB or RM-BASIC) is a dialect of the BASIC programming language created by Hewlett-Packard. It was especially popular for control of automatic test equipment using GPIB. It has several features which are or were unusual in BASIC dialects, such as event-driven operation, extensive external I/O support, complex number support, and matrix manipulation functions. Today, RMB is mainly used in environments where an investment in RMB software, hardware, or expertise already exists. | https://en.wikipedia.org/wiki/Rocky_Mountain_BASIC |
| High Tech BASIC | Rocky Mountain BASIC (also RMB or RM-BASIC) is a dialect of the BASIC programming language created by Hewlett-Packard. It was especially popular for control of automatic test equipment using GPIB. It has several features which are or were unusual in BASIC dialects, such as event-driven operation, extensive external I/O support, complex number support, and matrix manipulation functions. Today, RMB is mainly used in environments where an investment in RMB software, hardware, or expertise already exists. | https://en.wikipedia.org/wiki/High_Tech_BASIC |
| UniVerse | Rocket U2 is a suite of database management (DBMS) and supporting software now owned by Rocket Software. It includes two MultiValue database platforms: UniData and UniVerse. Both of these products are operating environments which run on current Unix, Linux and Windows operating systems. They are both derivatives of the Pick operating system. The family also includes developer and web-enabling technologies including SystemBuilder/SB+, SB/XA, U2 Web Development Environment (WebDE), UniObjects and wIntegrate. | https://en.wikipedia.org/wiki/UniVerse |
| Robot Battle | Robot Battle is a programming game for Microsoft Windows where players design and code adaptable battling robots. Robot Battle takes strategy rather than reflexes, accuracy, or timing to succeed. What differentiates one robot from the next is its programming, for which the player is responsible. The game is inspired by the similar game RobotWar. | https://en.wikipedia.org/wiki/Robot_Battle |
| RoboMind | RoboMind is a simple educational programming environment with its own scripting language that allows beginners to learn the basics of computer science by programming a simulated robot. In addition to introducing common programming techniques, it also aims at offering insights in robotics and artificial intelligence. RoboMind is available as stand-alone application for Windows, Linux and Mac OS X. It was first released in 2005 and was originally developed by Arvid Halma, a student of the University of Amsterdam at that time. Since 2011 RoboMind is published by Research Kitchen. | https://en.wikipedia.org/wiki/RoboMind |
| Robic | Robic (Russian: Робик) —a programming language created in the USSR for primary school education (8–11 years old children). The language was developed in 1975 and after changes was included in the Agat software system as "schoolgirl". The language uses syntax based on the Russian vocabulary. An interesting language feature is performer comprehension using, that is some object, that functions in some environment owned for each performer. It is possible to create and delete different types of performers. Each type of performer has its own command collection for main language command expansion. | https://en.wikipedia.org/wiki/Robic |
| RLaB | Rlab is an interactive, interpreted numerical computation program and its core programming language, written by Ian Searle. Rlab (the language) is very high level and is intended to provide fast prototyping and program development, as well as easy data-visualization, and processing. Rlab was not designed as a clone of MATLAB. However, as Rlab (the program) is intended to provide a good experimental environment (or laboratory) in which to do matrix math, the programming language possesses similar operators and concepts and could be called MATLAB-like. Rlab borrows some of the best features of the MATLAB language but provides them through a different syntax that has been modified in order to be more expressive while reducing ambiguity. The variable scoping rules facilitate the creation of larger programs and re-usable program libraries. A heterogeneous associative array datatype has been added to allow users to create and operate on arbitrary data structures. The fundamental data type is the dense floating point matrix (either real or complex), though string and sparse numerical matrices (both real and complex) are also provided. Rlab 2.1 is no longer under active development. Binary versions are available for Linux and for Windows, and source code is available under the GPL. Rlab 2.2 has been released as a part of the project rlabplus by Marijan Koštrun. | https://web.archive.org/web/20170310231827/https://en.wikipedia.org/wiki/Rlab |
| Ring | Ring is a dynamic and general-purpose programming language. It can be embedded in C/C++ projects, extended using C/C++ code and/or used as a standalone language. The supported programming paradigms are imperative, procedural, object-oriented, functional, Meta programming, declarative programming using nested structures, and natural programming. The language is portable (Windows, Linux, Mac OS X, Android, etc.) and can be used to create Console, GUI, Web, Games and Mobile applications. | https://en.wikipedia.org/wiki/Ring_(programming_language) |
| Rexx | Rexx (Restructured Extended Executor) is an interpreted programming language developed at IBM by Mike Cowlishaw. It is a structured, high-level programming language designed for ease of learning and reading. Proprietary and open source REXX interpreters exist for a wide range of computing platforms; compilers exist for IBM mainframe computers. Rexx is used as a scripting and macro language, and is often used for processing data and text and generating reports; these similarities with Perl mean that Rexx works well in Common Gateway Interface (CGI) programming and it is indeed used for this purpose. Rexx is the primary scripting language in some operating systems, e.g. OS/2, MVS, VM, AmigaOS, and is also used as an internal macro language in some other software, such as KEDIT, THE and the ZOC terminal emulator. Additionally, the Rexx language can be used for scripting and macros in any program that uses Windows Scripting Host ActiveX scripting engines languages (e.g. VBScript and JScript) if one of the Rexx engines is installed. Rexx is supplied with VM/SP on up, TSO/E Version 2 on up, OS/2 (1.3 and later, where it is officially named Procedures Language/2), AmigaOS Version 2 on up, PC DOS (7.0 or 2000), and Windows NT 4.0 (Resource Kit: Regina). REXX scripts for OS/2 share the filename extension .cmd with other scripting languages, and the first line of the script specifies the interpreter to be used. REXX macros for REXX-aware applications use extensions determined by the application. In the late 1980s Rexx became the common scripting language for IBM Systems Application Architecture, where it was renamed "SAA Procedure Language REXX." A Rexx script or command is sometimes referred to as an EXEC in a nod to Rexx's role as a replacement for the older EXEC command language on CP/CMS and VM/370 and EXEC 2 command language on VM/SP. | https://en.wikipedia.org/wiki/REXX |
| Rexon | Rexon Business Machines, later Rexon, Inc., was a manufacturer of small business computer systems founded by Ben C. Wang in 1978 in Culver City, California. It also became a major manufacturer of tape drives and related products. At its height, it played a significant role in the development and sale of magnetic tape data storage products. It traded on the NASDAQ under the symbol REXN until it filed for bankruptcy in 1995 and was acquired by Legacy Storage Systems, a Canadian company. It was last headquartered in Longmont, Colorado. | https://en.wikipedia.org/wiki/Rexon |
| Reverse Polish notation | Reverse Polish notation (RPN), also known as Polish postfix notation or simply postfix notation, is a mathematical notation in which operators follow their operands, in contrast to Polish notation (PN), in which operators precede their operands. It does not need any parentheses as long as each operator has a fixed number of operands. The description "Polish" refers to the nationality of logician Jan Łukasiewicz, who invented Polish notation in 1924.The reverse Polish scheme was proposed in 1954 by Arthur Burks, Don Warren, and Jesse Wright and was independently reinvented by Friedrich L. Bauer and Edsger W. Dijkstra in the early 1960s to reduce computer memory access and utilize the stack to evaluate expressions. The algorithms and notation for this scheme were extended by Australian philosopher and computer scientist Charles L. Hamblin in the mid-1950s.During the 1970s and 1980s, Hewlett-Packard used RPN in all of their desktop and hand-held calculators, and continued to use it in some into the 2010's. In computer science, reverse Polish notation is used in stack-oriented programming languages such as Forth and PostScript. Most of what follows is about binary operators. An example of a unary operator whose standard notation may be interpreted as reverse Polish notation is the factorial, "n!". | https://en.wikipedia.org/wiki/Reverse_Polish_notation |
| REST | Representational state transfer (REST) or RESTful web services are a way of providing interoperability between computer systems on the Internet. REST-compliant Web services allow requesting systems to access and manipulate textual representations of Web resources using a uniform and predefined set of stateless operations. Other forms of Web services exist, which expose their own arbitrary sets of operations such as WSDL and SOAP. "Web resources" were first defined on the World Wide Web as documents or files identified by their URLs, but today they have a much more generic and abstract definition encompassing every thing or entity that can be identified, named, addressed or handled, in any way whatsoever, on the Web. In a RESTful Web service, requests made to a resource's URI will elicit a response that may be in XML, HTML, JSON or some other defined format. The response may confirm that some alteration has been made to the stored resource, and it may provide hypertext links to other related resources or collections of resources. Using HTTP, as is most common, the kind of operations available include those predefined by the HTTP methods GET, POST, PUT, DELETE and so on. By using a stateless protocol and standard operations, REST systems aim for fast performance, reliability, and the ability to grow, by re-using components that can be managed and updated without affecting the system as a whole, even while it is running. The term representational state transfer was introduced and defined in 2000 by Roy Fielding in his doctoral dissertation. Fielding's dissertation explained the REST principles were known as the "HTTP object model" beginning in 1994, and were used in designing the HTTP 1.1 and Uniform Resource Identifiers (URI) standards. The term is intended to evoke an image of how a well-designed Web application behaves: it is a network of Web resources (a virtual state-machine) where the user progresses through the application by selecting links, such as /user/tom, and operations such as GET or DELETE (state transitions), resulting in the next resource (representing the next state of the application) being transferred to the user for their use. | https://en.wikipedia.org/wiki/Representational_state_transfer |
| RenderMan Shading Language | Renderman Shading Language (abbreviated RSL) is a component of the RenderMan Interface Specification, and is used to define shaders. The language syntax is C-like. A shader written in RSL can be used without changes on any RenderMan-compliant renderer, such as Pixar's PhotoRealistic RenderMan, DNA Research's 3Delight, Sitexgraphics' Air or an open source solution such as Pixie or Aqsis. RenderMan Shading Language defines standalone functions and five types of shaders: surface, light, volume, imager and displacement shaders. An example of a surface shader that defines a metal surface is: Shaders do the work by reading and writing special variables such as Cs (surface color), N (normal at given point), and Ci (final surface color). The arguments to the shaders are global parameters that are attached to objects of the model (so one metal shader can be used for different metals and so on). Shaders have no return values, but functions can be defined which take arguments and return a value. For example, the following function computes vector length using the dot product operator ".": | https://en.wikipedia.org/wiki/RenderMan_Shading_Language |
| RenderScript | RenderScript is a component of the Android operating system for mobile devices that offers an API for acceleration that takes advantage of heterogeneous hardware. It allows developers to increase the performance of their applications at the cost of writing more complex (lower-level) code. It provides the developer three primary tools: A simple 3D rendering API, a compute API similar to CUDA, and a C99-derived language. | https://en.wikipedia.org/wiki/RenderScript |
| Refal | Refal (Recursive functions algorithmic language) "is functional programming language oriented toward symbol manipulation", including "string processing, translation, [and] artificial intelligence". It is one of the oldest members of this family, first conceived in 1966 as a theoretical tool with the first implementation appearing in 1968. Refal was intended to combine mathematical simplicity with practicality for writing large and sophisticated programs. Unlike other functional programming languages, Refal is based on pattern matching. Its pattern matching works in the forward direction rather than backwards (starting from the goal) as in Prolog. The basic data structure of Lisp and Prolog is a linear list consed up from the beginning. Refal lists are built and scanned from both ends, and pattern matching allows to match against nested lists as well as the top-level one. (In effect, the basic data structure of Refal is a tree rather than a list). According to the authors, this gives freedom and convenience in creating data structures while using only mathematically simple control mechanisms of pattern matching and substitution. Refal also includes a feature called the freezer to support efficient partial evaluation. Refal can be applied to the processing and transformation of tree structures, similarly to XSLT. | https://en.wikipedia.org/wiki/Refal |
| REDUCE | Reduce is a general-purpose computer algebra system geared towards applications in physics. The development of the Reduce computer algebra system was started in the 1960s by Anthony C. Hearn. Since then, many scientists from all over the world have contributed to its development under his direction. Reduce is written entirely in its own LISP dialect called Portable Standard Lisp, expressed in an ALGOL-like syntax called RLISP. The latter is used as a basis for Reduce's user-level language. Implementations of Reduce are available on most variants of Unix, Linux, Microsoft Windows, or Apple Macintosh systems by using an underlying Portable Standard Lisp or Codemist Standard LISP implementation. Reduce was open sourced in December 2008 and is available for free under a modified BSD license on SourceForge. Previously it had cost $695. | https://en.wikipedia.org/wiki/REDUCE |
| Redis | Redis is an open-source in-memory database project implementing a distributed, in-memory key-value store with optional durability. Redis supports different kinds of abstract data structures, such as strings, lists, maps, sets, sorted sets, hyperloglogs, bitmaps and spatial indexes. The project is mainly developed by Salvatore Sanfilippo and is currently sponsored by Redis Labs. Redis Labs creates and maintains the official Redis Enterprise Pack. | https://en.wikipedia.org/wiki/Redis |
| Red | Red is a computer programming language. Red was made to overcome the limitations of the programming language Rebol. Introduced in 2011 by Nenad Rakocevic, Red is both an imperative and functional programming language. Its syntax and general usage overlaps that of the interpreted Rebol language (which was introduced in 1997). The implementation choices of Red intend to create a full stack programming language: Red can be used for extremely high-level programming (DSLs and GUIs) as well as low-level programming (operating systems and device drivers). Key to the approach is that the language has two parts: Red/System and Red. Red/System is similar to C, but packaged into a Rebol lexical structure – for example, one would write if x > y [print "Hello"] instead of if (x > y) {printf("Hello\n");}. Red is a homoiconic language capable of meta-programming, with semantics similar to Rebol's. Red's runtime library is written in Red/System, and uses a hybrid approach: it compiles what it can deduce statically and uses an embedded interpreter otherwise. The project roadmap includes a just-in-time compiler for cases in between, but this has not yet been implemented. Red seeks to remain independent of any other toolchain; it does its own code generation. It is therefore possible to cross-compile Red programs from any platform it supports to any other, via a command-line switch. Both Red and Red/System are distributed as open-source software under the modified BSD license. The runtime library is distributed under the more permissive Boost Software License. | https://en.wikipedia.org/wiki/Red_(programming_language) |
| REBOL | Rebol ( REB-əl; historically REBOL) is a cross-platform data exchange language and a multi-paradigm dynamic programming language designed by Carl Sassenrath for network communications and distributed computing. It introduces the concept of dialecting: small, optimized, domain-specific languages for code and data, which is also the most notable property of the language according to its designer Carl Sassenrath: Although it can be used for programming, writing functions, and performing processes, its greatest strength is the ability to easily create domain-specific languages or dialects Douglas Crockford, known for his involvement in the development of JavaScript, has described Rebol as "a more modern language, but with some very similar ideas to Lisp, in that it's all built upon a representation of data which is then executable as programs" and as one of JSON's influences. Originally, the language and its official implementation were proprietary and closed source, developed by REBOL Technologies. Following discussion with Lawrence Rosen, the Rebol version 3 interpreter was released under the Apache 2.0 license on December 12, 2012. Older versions are only available in binary form, and no source release for them is planned. Rebol has been used to program Internet applications (both client- and server-side), database applications, utilities, and multimedia applications. | https://en.wikipedia.org/wiki/REBOL |
| Rebeca Modeling Language | Rebeca (acronym for Reactive Objects Language) is an actor-based modeling language with a formal foundation, designed in an effort to bridge the gap between formal verification approaches and real applications. It can be considered as a reference model for concurrent computation, based on an operational interpretation of the actor model. It is also a platform for developing object-based concurrent systems in practice. Besides having an appropriate and efficient way for modeling concurrent and distributed systems, one needs a formal verification approach to ensure their correctness. Rebeca is supported by a set of verification tools. Earlier tools provided a front-end to work with Rebeca code, and to translate the Rebeca code into input languages of well-known and mature model checkers (like SPIN and NuSMV) and thus, were able to verify their properties. Rebeca, since 2005, is supported by a direct model checker based on Modere (the Model checking Engine of Rebeca). Modular verification and abstraction techniques are used to reduce the state space and make it possible to verify complicated reactive systems. Besides these techniques, Modere supports partial order reduction and symmetry reduction. | https://en.wikipedia.org/wiki/Rebeca_Modeling_Language |
| Real-time Cmix | Real-Time Cmix (RTcmix) is one of the MUSIC-N family of computer music programming languages. RTcmix is descended from the MIX program developed by Paul Lansky at Princeton University in 1978 to perform algorithmic composition using digital audio soundfiles on a IBM 3031 mainframe computer. After synthesis functions were added, the program was renamed Cmix in the 1980s. Real-time capability was added by Brad Garton and David Topper in the mid-1990s, with support for TCP socket connectivity, interactive control of the scheduler, and object-oriented embedding of the synthesis engine into fully featured applications. Over the years Cmix/RTcmix has run on a variety of computer platforms and operating systems, including NeXT, Sun Microsystems, IRIX, Linux, and Mac OS X. It is and has always been an open source project, differentiating it from commercial synthesizers and music software. It is currently developed by a group of computer music researchers at Princeton, Columbia University, and the University of Virginia. RTcmix has a number of unique (or highly unusual) features when compared with other synthesis and signal processing languages. For one, it has a built-in MINC parser, which enables the user to write C-style code within the score file, extending its innate capability for algorithmic composition and making it closer in some respects to later music software such as SuperCollider and Max/MSP. It uses a single-script instruction file (the score file), and synthesis and signal processing routines (called instruments) exist as compile shared libraries. This is different from MUSIC-N languages such as Csound where the instruments exist in a second file written in a specification language that builds the routines out of simple building blocks (organized as opcodes or unit generators). RTcmix has similar functionality to Csound and other computer music languages, however, and their shared lineage means that scripts written for one language will be extremely familiar-looking (if not immediately comprehensible) to users of the other language. | https://en.wikipedia.org/wiki/Real-time_Cmix |
| RATFOR | Ratfor (short for Rational Fortran) is a programming language implemented as a preprocessor for Fortran 66. It provided modern control structures, unavailable in Fortran 66, to replace GOTOs and statement numbers. | https://en.wikipedia.org/wiki/Ratfor |
| Ratfiv | Ratfiv is an enhanced version of the Ratfor programming language, a preprocessor for Fortran designed to give it C-like capabilities. Fortran was widely used for scientific programming but had very basic control-flow primitives ("do" and "goto") and no "macro" facility which limited its expressiveness. The name of the language is a pun (Ratfor (RATional FORtran) -> "Rat Four" -> "Rat Five" -> RatFiv). Ratfiv was developed by Bill Wood at the Institute for Cancer Research, Philadelphia, PA in the early 1980s and released on several DECUS (Digital Equipment Users Group) SIG (Special Interest Group) tapes. It is based on the original Ratfor by B. Kernighan and P. J. Plauger, with rewrites and enhancements by David Hanson and friends (U. of Arizona), Joe Sventek and Debbie Scherrer (Lawrence Berkeley National Laboratory). Ratfiv V2.1 was distributed on the DECUS RSX82a SIG tape. | https://en.wikipedia.org/wiki/Ratfiv |
| RascalMPL | Rascal is an experimental domain specific language for metaprogramming, such as static code analysis, program transformation and implementation of domain specific languages. It is a general meta language in the sense that it does not have a bias for any particular software language. It includes primitives from relational calculus and term rewriting. Its syntax and semantics are based on procedural (imperative) and functional programming. | https://en.wikipedia.org/wiki/RascalMPL |
| Rascal | Rascal is an experimental domain specific language for metaprogramming, such as static code analysis, program transformation and implementation of domain specific languages. It is a general meta language in the sense that it does not have a bias for any particular software language. It includes primitives from relational calculus and term rewriting. Its syntax and semantics are based on procedural (imperative) and functional programming. | https://en.wikipedia.org/wiki/RascalMPL |
| Rapira | Rapira is also a name for the T-12 antitank gun. Rapira (Russian: Рапира, rapier) is an educational procedural programming language developed in the Soviet Union and implemented on Agat computer, PDP-11 clones (Electronika, DVK, BK series) and Intel-8080/Z80 clones (Korvet). It was an interpreted language with dynamic type system and high level constructions. The language originally had a Russian-based set of keywords, but English and Moldovan were added later. Also, it was more elegant and easier to use than existing Pascal implementations of the time. Rapira was used in teaching computer programming in Soviet schools. The programming environment included a text editor and an integrated debugger. Sample program: ПРОЦ СТАРТ() ВЫВОД: 'Привет, мир!!!' КОН ПРОЦ The same, but using the English lexics [sic, from the article referenced below]: proc start() output: 'Hello, world!!!'; end proc Rapira's ideology was based on such languages as POP-2 and SETL, with strong influences from ALGOL. | https://en.wikipedia.org/wiki/Rapira |
| RapidQ | RapidQ (also known as Rapid-Q) is a free, cross-platform, semi-object-oriented dialect of the BASIC programming language. It can create console, graphical user interface, and Common Gateway Interface applications. The integrated development environment includes a drag-and-drop form designer, syntax highlighting, and single-button compilation. Versions are available for Microsoft Windows, Linux, Solaris, and HP-UX. Additional functionality not normally seen in BASIC languages are function callbacks and primitive object-orientation. The language is called semi-object-oriented by its author because there are only two levels of the class hierarchy: built-in classes, and user-defined classes derived from those; the latter cannot be extended further. The ability to call external shared libraries is available, thus giving full access to the underlying operating system's application program interface. Other capabilities include built-in interfaces to DirectX and MySQL. RapidQ features a bytecode compiler that produces standalone executables by binding the generated bytecode with the interpreter. No external run time libraries are needed; the bytecode interpreter is self-contained. The file sizes of executable files created by RapidQ are about 150 kilobytes or larger for console applications. RapidQ's author, William Yu, sold the source code to REAL Software, the makers of REALbasic, in 2000.The freely distributed program has been improved and many additional components have been created by an active user group. | https://en.wikipedia.org/wiki/RapidQ |
| Raku | Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019.While historically several interpreter and compiler implementations were being written, today only the Rakudo implementation is in active development. Raku introduces elements of many modern and historical languages. Compatibility with Perl is not a goal, though a compatibility mode is part of the specification. The design process for Raku began in 2000. In February 2015 a post on The Perl Foundation blog stated that "The Perl6 team will attempt to get a development release of version 1.0 available for Larry's birthday in September and a Version 1.0 release by Christmas", and on 25 December 2015, the first stable version of the specification was announced.Development on Pugs, the first high-traction implementation, began in 2005, and there have been multiple Raku implementation projects. Rakudo is based on NQP (Not Quite Perl) and can use MoarVM or the Java Virtual Machine as a runtime environment, and releases a new version every month (including precompiled Linux packages); in July 2010, the project released the first Rakudo Star distribution, a collection of a Raku implementation and related materials. Larry Wall maintains a reference grammar known as STD.pm6, written in Raku and bootstrapped with Perl. | https://en.wikipedia.org/wiki/Raku_(programming_language) |
| Ragel | Ragel is a finite-state machine compiler and a parser generator. Initially Ragel supported output for C, C++ and Assembly source code,. Although subsequently extended to support several other languages (said to be Objective C, D, Go, Ruby, and Java) this support of other languages was withdrawn . It supports the generation of table or control flow driven state machines from regular expressions and/or state charts and can also build lexical analysers via the longest-match method. Ragel specifically targets text parsing and input validation. | https://en.wikipedia.org/wiki/Ragel |
| Racket | Racket is a general purpose, multi-paradigm programming language in the Lisp-Scheme family. One of its design goals is to serve as a platform for language creation, design, and implementation. The language is used in a variety of contexts such as scripting, general-purpose programming, computer science education, and research. The platform provides an implementation of the Racket language (including a sophisticated run-time system, various libraries, JIT compiler, and more) along with a development environment called DrRacket (formerly named DrScheme) written in Racket itself. The IDE and an accompanying programming curriculum is used in the ProgramByDesign outreach program, an attempt to turn computing and programming into "an indispensable part of the liberal arts curriculum". The core language is known for its extensive macro system which enables the creation of embedded and domain-specific languages, language constructs such as classes or modules, and separate dialects of Racket with different semantics. The platform distribution is free and open-source software distributed under the GNU Lesser General Public License (LGPL) license. Extensions and packages written by the community are uploaded to Racket's centralized package catalog. While the Racket distribution continues to support Scheme variants, the new Racket language was launched on 7 June 2010, Racket was launched. https://racket-lang.org/new-name.html | https://en.wikipedia.org/wiki/Racket_(programming_language) |
| RTL/2 | RTL/2 was a high-level programming language developed at Imperial Chemical Industries Ltd by J.G.P. Barnes. It was originally used internally within ICI but was distributed by SPL International in 1974 It was designed for use in real-time computing (hence the initials RTL = real-time language). Based on concepts from Algol 68, it was intended to be a small, simple language. RTL/2 was standardised in 1980 by the British Standards Institution.RTL/2 was a strongly typed language with separate compilation. The compilation units contained one or more items known as "bricks", i.e.: procedure bricks, data bricks, stack bricks.A procedure brick was a procedure, which may or may not return a (scalar) value, have (scalar) parameters, or have local (scalar) variables. The entry mechanism and implementation of local variables was re-entrant. Non-scalar data could only be accessed via reference (so-called REF variables were considered scalar). A data brick was a named static collection of scalars, arrays and records. Programmers had to implement memory management themselves (there was no heap or garbage collection). A stack brick was an area of storage reserved for running all the procedures of a single process and contained the call stack, local variables and other housekeeping items. The extent to which stack bricks were actually used varied depending upon the host environment in which RTL/2 programs actually ran. Access to the host environment of an RTL/2 program was provided via special procedure and data bricks called SVC procedures and SVC data. These were accessible in RTL/2 but implemented in some other language in the host environment. | https://en.wikipedia.org/wiki/RTL/2 |
| RStudio | RStudio is a free and open-source integrated development environment (IDE) for R, a programming language for statistical computing and graphics. RStudio was founded by JJ Allaire, creator of the programming language ColdFusion. Hadley Wickham is the Chief Scientist at RStudio.RStudio is available in two editions: RStudio Desktop, where the program is run locally as a regular desktop application; and RStudio Server, which allows accessing RStudio using a web browser while it is running on a remote Linux server. Prepackaged distributions of RStudio Desktop are available for Windows, macOS, and Linux. RStudio is available in open source and commercial editions and runs on the desktop (Windows, macOS, and Linux) or in a browser connected to RStudio Server or RStudio Server Pro (Debian, Ubuntu, Red Hat Linux, CentOS, openSUSE and SLES).RStudio is partly written in the C++ programming language and uses the Qt framework for its graphical user interface. The bigger percentage of the code is written in Java, JavaScript is also amongst the languages used.Work on RStudio started around December 2010, and the first public beta version (v0.92) was officially announced in February 2011. Version 1.0 was released on 1 November 2016. Version 1.1 was released on 9 October 2017. In April 2018 it was announced RStudio will be providing operational and infrastructure support for Ursa Labs. Ursa Labs will focus on building a new data science runtime powered by Apache Arrow. | https://en.wikipedia.org/wiki/RStudio |
| Rpm | RPM Package Manager (RPM) (originally Red Hat Package Manager; now a recursive acronym) is a package management system. The name RPM refers to the following: the .rpm file format, files in the .rpm file format, software packaged in such files, and the package manager program itself. RPM was intended primarily for Linux distributions; the file format is the baseline package format of the Linux Standard Base. Even though it was created for use in Red Hat Linux, RPM is now used in many Linux distributions. It has also been ported to some other operating systems, such as Novell NetWare (as of version 6.5 SP3), IBM's AIX (as of version 4), CentOS, Fedora (operating system) created jointly between Red Hat and the Fedora community, and Oracle Linux. All versions or variants of the these Linux operating systems use the RPM Package Manager. An RPM package can contain an arbitrary set of files. The larger part of RPM files encountered are “binary RPMs” (or BRPMs) containing the compiled version of some software. There are also “source RPMs” (or SRPMs) files containing the source code used to produce a package. These have an appropriate tag in the file header that distinguishes them from normal (B)RPMs, causing them to be extracted to /usr/src on installation. SRPMs customarily carry the file extension “.src.rpm” (.spm on file systems limited to 3 extension characters, e.g. old DOS FAT). | https://en.wikipedia.org/wiki/Rpm_(software) |
| RPL | RPL (derived from Reverse Polish Lisp according to its original developers, whilst for a short while in 1987 HP marketing attempted to coin the backronym ROM-based Procedural Language for it) is a handheld calculator operating system and application programming language used on Hewlett-Packard's scientific graphing RPN (Reverse Polish Notation) calculators of the HP 28, 48, 49 and 50 series, but it is also usable on non-RPN calculators, such as the 38, 39 and 40 series. RPL is a structured programming language based on RPN, but equally capable of processing algebraic expressions and formulae, implemented as a threaded interpreter. RPL has many similarities to Forth, both languages being stack-based, as well as the list-based LISP. Contrary to previous HP RPN calculators, which had a fixed four-level stack, the stack used by RPL is only limited by available calculator RAM. RPL originated from HP's Corvallis, Oregon development facility in 1984 as a replacement for the previous practice of implementing the operating systems of calculators in assembly language. The last calculator supporting RPL, the HP 50g, was discontinued in 2015. | https://en.wikipedia.org/wiki/RPL_(programming_language) |
| RPG | RPG is a high-level programming language (HLL) for business applications. RPG is an IBM proprietary programming language and its later versions are available only on IBM i- or OS/400-based systems. It has a long history, having been developed by IBM in 1959 as the Report Program Generator - a tool to replicate punched card processing on the IBM 1401 then updated to RPG II for the IBM System/3 in the late 1960s, and since evolved into an HLL equivalent to COBOL and PL/I. It remains a popular programming language on the IBM i operating system, which runs on IBM Power i platform hardware. The current version, RPG IV (a.k.a. ILE RPG), provides a modern programming environment. | https://en.wikipedia.org/wiki/IBM_RPG |
| ROOT | ROOT is an object-oriented program and library developed by CERN. It was originally designed for particle physics data analysis and contains several features specific to this field, but it is also used in other applications such as astronomy and data mining. Release 6.14.04 as of 2018-08-23 | https://en.wikipedia.org/wiki/ROOT |
| ROOP | ROOP is a multiparadigm programming language targeted at AI applications created at the Chengdu University of China. It combines rule-based, procedural, logical and object-oriented programming techniques. | https://en.wikipedia.org/wiki/ROOP_(programming_language) |
| RISC-V | RISC-V (pronounced "risk-five") is an open instruction set architecture (ISA) based on established reduced instruction set computing (RISC) principles. In contrast to most ISAs, the RISC-V ISA can be freely used for any purpose, permitting anyone to design, manufacture and sell RISC-V chips and software. While not the first open ISA, it is significant because it is designed to be useful in modern computerized devices such as warehouse-scale cloud computers, high-end mobile phones and the smallest embedded systems. Such uses demand that the designers consider both performance and power efficiency. The instruction set also has a substantial body of supporting software, which fixes a usual weakness of new instruction sets. The project began in 2010 at the University of California, Berkeley, but many contributors are volunteers and industry workers outside the university. The RISC-V ISA has been designed with small, fast, and low-power real-world implementations in mind, but without over-architecting for a particular microarchitecture style. As of May 2017, version 2.2 of the userspace ISA is fixed and the privileged ISA is available as draft version 1.10. | https://en.wikipedia.org/wiki/RISC-V |
| RDoc | RDoc, designed by Dave Thomas, is an embedded documentation generator for the Ruby programming language. It analyzes Ruby source code, generating a structured collection of pages for Ruby objects and methods. Code comments can be added in a natural style. RDoc is included as part of the Ruby core distribution. The RDoc software and format are successors to the Ruby Document format (with associated software RD). RDoc can produce usable documentation even if the target source code does not contain explicit comments as it will still parse the classes, modules, and methods, and list them in the generated API files. RDoc also provides the engine for creating Ruby ri data files, providing access to API information from the command line. RDoc and ri are currently maintained by Eric Hodel and Ryan Davis. | https://en.wikipedia.org/wiki/RDoc |
| RDFa | RDFa (or Resource Description Framework in Attributes) is a W3C Recommendation that adds a set of attribute-level extensions to HTML, XHTML and various XML-based document types for embedding rich metadata within Web documents. The RDF data-model mapping enables its use for embedding RDF subject-predicate-object expressions within XHTML documents. It also enables the extraction of RDF model triples by compliant user agents. The RDFa community runs a wiki website to host tools, examples, and tutorials. | https://en.wikipedia.org/wiki/RDFa |
| RDF Schema | RDF Schema (Resource Description Framework Schema, variously abbreviated as RDFS, RDF(S), RDF-S, or RDF/S) is a set of classes with certain properties using the RDF extensible knowledge representation data model, providing basic elements for the description of ontologies, otherwise called RDF vocabularies, intended to structure RDF resources. These resources can be saved in a triplestore to reach them with the query language SPARQL. The first version was published by the World-Wide Web Consortium (W3C) in April 1998, and the final W3C recommendation was released in February 2004. Many RDFS components are included in the more expressive Web Ontology Language (OWL). | https://en.wikipedia.org/wiki/RDF_Schema |
| Ruby Document format | RD (Ruby Document) is a lightweight markup language for writing Ruby-related documents. It can be embedded in Ruby source code. RD is a traditional format. In modern Ruby, developers tend to write documents in RDoc instead of RD. | https://en.wikipedia.org/wiki/Ruby_Document_format |
| RAPID | RAPID is a high-level programming language used to control ABB industrial robots. RAPID was introduced along with S4 Control System in 1994 by ABB, superseding the ARLA programming language. Features in the language include: Routine parameters: Procedures - used as a subprogram. Functions - return a value of a specific type and are used as an argument of an instruction. Trap routines - a means of responding to interrupts. Arithmetic and logical expressions Automatic error handling Modular programs Multi tasking | https://en.wikipedia.org/wiki/RAPID |
| Ramis software | RAMIS (Random Access Management Information System) is a fourth-generation programming language (4GL) capable of creating and maintaining databases consisting of named files containing both numeric and alphabetic fields and subsequently producing detailed simple or complex reports using a very simple English like language. As such it is easily mastered by non-programmers. A typical program - either to create or maintain a database or to create quite complex reports - would normally consist of a handful of lines of code which could be written or understood by non-professional programmers. "End users" as they became known. Such end users could be trained to use RAMIS in a matter of days and so large companies would often have several hundred such users scattered throughout the company. | https://en.wikipedia.org/wiki/Ramis_software |
| R++ | R++ is a rule-based programming language based on C++. The United States patent describes R++ as follows: The R++ extension permits rules to be defined as members of C++ classes. The programming system of the invention takes the classes with rules defined using R++ and generates C++ code from them in which the machinery required for the rules is implemented completely as C++ data members and functions of the classes involved in the rules. R++ was developed by Bell Labs in the 1990s, but due to the Bell System divestiture that split the legal rights to the work developed at the Laboratories between AT&T and Lucent, did not see immediate commercial development while the two companies disputed ownership. | https://en.wikipedia.org/wiki/R%2B%2B |
| R | R is an open source programming language and software environment for statistical computing and graphics that is supported by the R Foundation for Statistical Computing. The R language is widely used among statisticians and data miners for developing statistical software and data analysis. Polls, surveys of data miners, and studies of scholarly literature databases show that R's popularity has increased substantially in recent years. R is a GNU package. The source code for the R software environment is written primarily in C, Fortran, and R. R is freely available under the GNU General Public License, and pre-compiled binary versions are provided for various operating systems. While R has a command line interface, there are several graphical front-ends available. | https://en.wikipedia.org/wiki/R_(programming_language) |
| QUTE | Qute is a Japanese video game company created in 1999. Apart from game development, they offer technology consultancy in other areas such as health care or graphic design. | https://en.wikipedia.org/wiki/Qute |
| Quicken Interchange Format | Quicken Interchange Format (QIF) is an open specification for reading and writing financial data to media (i.e. files). | https://en.wikipedia.org/wiki/Quicken_Interchange_Format |
| Query by Example | Query by Example (QBE) is a database query language for relational databases. It was devised by Moshé M. Zloof at IBM Research during the mid-1970s, in parallel to the development of SQL. It is the first graphical query language, using visual tables where the user would enter commands, example elements and conditions. Many graphical front-ends for databases use the ideas from QBE today. Originally limited only for the purpose of retrieving data, QBE was later extended to allow other operations, such as inserts, deletes and updates, as well as creation of temporary tables. The motivation behind QBE is that a parser can convert the user's actions into statements expressed in a database manipulation language, such as SQL. Behind the scenes, it is this statement that is actually executed. A suitably comprehensive front-end can minimize the burden on the user to remember the finer details of SQL, and it is easier and more productive for end-users (and even programmers) to select tables and columns by selecting them rather than typing in their names, In the context of information retrieval, QBE has a somewhat different meaning. The user can submit a document, or several documents, and ask for "similar" documents to be retrieved from a document database [see search by multiple examples]. Similarity search is based comparing document vectors (see Vector Space Model). QBE is a seminal work in end-user development, frequently cited in research papers as an early example of this topic. Currently, QBE is supported in several relational database front ends, notably Microsoft Access, which implements "Visual Query by Example", as well as Microsoft SQL Server Enterprise Manager. It is also implemented in several object-oriented databases (e.g. in db4o). QBE is based on the logical formalism called tableau query, although QBE adds some extensions to that, much like SQL is based on the relational algebra. | https://en.wikipedia.org/wiki/Query_by_Example |
| QuakeC | QuakeC is an interpreted language developed in 1996 by John Carmack of id Software to program parts of the video game Quake. Using QuakeC, a programmer is able to customize Quake to great extents by adding weapons, changing game logic and physics, and programming complex scenarios. It can be used to control many aspects of the game itself, such as parts of the AI, triggers, or changes in the level. The Quake engine was the only game engine to use QuakeC. Following engines used DLL game modules for customization written in C and C++ from id Tech 4 on. | https://en.wikipedia.org/wiki/QuakeC |
| QtScript | QtScript is a scripting engine that has been part of the Qt cross-platform application framework since version 4.3.0. The scripting language is based on the ECMAScript standard with a few extensions, such as QObject-style signal and slot connections. The library contains the engine, and a C++ API for evaluating QtScript code and exposing custom QObject-derived C++ classes to QtScript. The QtScript Binding Generator provides bindings for the Qt API to access directly from ECMAScript. QtScript and the binding generator are used for Amarok 2's scripting system. The current (as of Qt 4.7) implementation uses JavaScriptCore and will not be further developed. The module is deprecated as of Qt 5.5. | https://en.wikipedia.org/wiki/QtScript |
| Qt | Qt ( "cute") is a cross-platform application framework that is used for developing application software that can be run on various software and hardware platforms with little or no change in the underlying codebase, while still being a native application with native capabilities and speed. Qt is currently being developed both by The Qt Company, a publicly listed company, and the Qt Project under open-source governance, involving individual developers and firms working to advance Qt. Qt is available with both proprietary and open source GPL 2.0, GPL 3.0, and LGPL 3.0 licenses. | https://en.wikipedia.org/wiki/Qt_(software) |
| Qore | Qore is an interpreted, high-level, general-purpose, garbage collected dynamic programming language, featuring support for code embedding and sandboxing with optional strong typing and a focus on fundamental support for multithreading and SMP scalability. Qore is unique because it is an interpreted scripting language with fundamental support for multithreading (meaning more than one part of the same code can run at the same time), and additionally because it features automatic memory management (meaning programmers do not have to allocate and free memory explicitly) while also supporting the RAII idiom with destructors for scope-based resource management and exception-safe programming. This is due to Qore's unique prompt collection implementation for garbage collection. | https://en.wikipedia.org/wiki/Qore_(programming_language) |
| QUIKSCRIPT | QUIKSCRIPT is a simulation language derived from SIMSCRIPT, based on 20-GATE. | https://en.wikipedia.org/wiki/QUIKSCRIPT |
| QUEL | QUEL is a relational database query language, based on tuple relational calculus, with some similarities to SQL. It was created as a part of the Ingres DBMS effort at University of California, Berkeley, based on Codd's earlier suggested but not implemented Data Sub-Language ALPHA. QUEL was used for a short time in most products based on the freely available Ingres source code, most notably in an implementation called POSTQUEL supported by POSTGRES. As Oracle and DB2 gained market share in the early 1980s, most companies then supporting QUEL moved to SQL instead. QUEL continues to be available as a part of the Ingres DBMS, although no QUEL-specific language enhancements have been added for many years. | https://en.wikipedia.org/wiki/QUEL_query_languages |
| QR code | QR code (abbreviated from Quick Response code) is the trademark for a type of matrix barcode (or two-dimensional barcode) first designed in 1994 for the automotive industry in Japan. A barcode is a machine-readable optical label that contains information about the item to which it is attached. In practice, QR codes often contain data for a locator, identifier, or tracker that points to a website or application. A QR code uses four standardized encoding modes (numeric, alphanumeric, byte/binary, and kanji) to store data efficiently; extensions may also be used.The Quick Response system became popular outside the automotive industry due to its fast readability and greater storage capacity compared to standard UPC barcodes. Applications include product tracking, item identification, time tracking, document management, and general marketing.A QR code consists of black squares arranged in a square grid on a white background, which can be read by an imaging device such as a camera, and processed using Reed–Solomon error correction until the image can be appropriately interpreted. The required data is then extracted from patterns that are present in both horizontal and vertical components of the image. | https://en.wikipedia.org/wiki/QR_code |
| QML | QML (Qt Modeling Language) is a user interface markup language. It is a declarative language (similar to CSS and JSON) for designing user interface–centric applications. Inline JavaScript code handles imperative aspects. It is associated with Qt Quick, the UI creation kit originally developed by Nokia within the Qt framework. Qt Quick is often used for mobile applications where touch input, fluid animations (60 FPS) and user experience are crucial. QML is also used with Qt3D to describe a 3D scene and a "frame graph" rendering methodology. A QML document describes a hierarchical object tree. QML modules shipped with Qt include primitive graphical building blocks (e.g., Rectangle, Image), modeling components (e.g., FolderListModel, XmlListModel), behavioral components (e.g., TapHandler, DragHandler, State, Transition, Animation), and more complex controls (e.g., Button, Slider, Drawer, Menu). These elements can be combined to build components ranging in complexity from simple buttons and sliders, to complete internet-enabled programs. QML elements can be augmented by standard JavaScript both inline and via included .js files. Elements can also be seamlessly integrated and extended by C++ components using the Qt framework. QML is the language; its JavaScript runtime is the custom V4 engine, since Qt 5.2; and Qt Quick is the 2D scene graph and the UI framework based on it. These are all part of the Qt Declarative module, while the technology is no longer called Qt Declarative. QML and JavaScript code can be compiled into native C++ binaries with the Qt Quick Compiler. Alternatively there is a QML cache file format which stores a compiled version of QML dynamically for faster startup the next time it is run. | https://en.wikipedia.org/wiki/QML |
| QBasic | QBasic (Quick Beginners All purpose Symbolic Instruction Code) is an IDE and interpreter for a variety of the BASIC programming language which is based on QuickBASIC. Code entered into the IDE is compiled to an intermediate representation, and this IR is immediately interpreted on demand within the IDE. It can run under nearly all versions of DOS and 32-bit versions of Windows, or through emulation via DOSBox/DOSEMU on Linux, FreeBSD, and 64-bit versions of Windows. (QBasic is a DOS program and requires DOS or a DOS emulator. Windows XP comes with an emulator called DOS Virtual Machine, subsequent versions of Windows require an emulator such as DosBox.) For its time, QBasic provided a state-of-the-art IDE, including a debugger with features such as on-the-fly expression evaluation and code modification. It supports various inbuilt functions. Like QuickBASIC, but unlike earlier versions of Microsoft BASIC, QBasic is a structured programming language, supporting constructs such as subroutines and while loops. Line numbers, a concept often associated with BASIC, are supported for compatibility, but are not considered good form, having been replaced by descriptive line labels. QBasic has limited support for user-defined data types (structures), and several primitive types used to contain strings of text or numeric data. | https://en.wikipedia.org/wiki/QBasic |
| QB64 | QB64 (originally QB32) is a self-hosting BASIC compiler for Microsoft Windows, Linux and Mac OS X, designed to be compatible with Microsoft QBasic and QuickBASIC. QB64 is a C++ emitter, which is integrated with a C++ compiler to provide compilation via C++ code and GCC optimization.QB64 implements most QBasic statements, and can run many QBasic programs, including Microsoft's QBasic Gorillas and Nibbles games. Furthermore, QB64 has been designed to contain an IDE resembling the QBASIC IDE. QB64 also extends the QBASIC programming language to include 64-bit data types, as well as better sound and graphics support. It can also emulate some DOS/x86 specific features such as INT 33h mouse access, and multiple timers. | https://en.wikipedia.org/wiki/QB64 |
| Q | Q is a proprietary array processing language developed by Arthur Whitney and commercialized by Kx Systems. The language serves as the query language for kdb+, a disk based and in-memory, column-based database. kdb+ is based upon K, a terse variant of APL. Q is a thin wrapper around K, providing a more readable, English-like interface. | https://en.wikipedia.org/wiki/Q_(programming_language_from_Kx_Systems) |
| P′′ | P′′ is a primitive computer programming language created by Corrado Böhm in 1964 to describe a family of Turing machines. | https://en.wikipedia.org/wiki/P′′ |
| Python | Python is a widely used high-level programming language for general-purpose programming, created by Guido van Rossum and first released in 1991. An interpreted language, Python has a design philosophy that emphasizes code readability (notably using whitespace indentation to delimit code blocks rather than curly brackets or keywords), and a syntax that allows programmers to express concepts in fewer lines of code than might be used in languages such as C++ or Java. It provides constructs that enable clear programming on both small and large scales. Python features a dynamic type system and automatic memory management. It supports multiple programming paradigms, including object-oriented, imperative, functional and procedural, and has a large and comprehensive standard library. Python interpreters are available for many operating systems. CPython, the reference implementation of Python, is open source software and has a community-based development model, as do nearly all of its variant implementations. CPython is managed by the non-profit Python Software Foundation. | https://en.wikipedia.org/wiki/Python_(programming_language) |
| Pyrex | Pyrex is a programming language developed to aid in creating Python modules. Its syntax is very close to Python. The goal is to make it easy for Python programmers to write the non-Python supporting code usually required for interfacing modules in a language which is as close to Python as possible. | https://en.wikipedia.org/wiki/Pyrex_(programming_language) |
| PyTorch | PyTorch is an open-source machine learning library for Python, based on Torch, used for applications such as natural language processing. It is primarily developed by Facebook's artificial-intelligence research group, and Uber's "Pyro" software for probabilistic programming is built on it.PyTorch provides two high-level features: Tensor computation (like NumPy) with strong GPU acceleration Deep Neural Networks built on a tape-based autodiff system | https://en.wikipedia.org/wiki/PyTorch |
| PureBasic | PureBasic is a commercially distributed procedural computer programming language and integrated development environment based on BASIC and developed by Fantaisie Software for Windows 32/64-bit, Linux 32/64-bit, and macOS. An Amiga version is available, although it has been discontinued and some parts of it are released as open source. The first public release of PureBasic for Windows was on December 17, 2000. It has been continually updated since. PureBasic has a "lifetime license model". As cited on the website, the very first PureBasic user (who registered in 1998) still has free access to new updates and this is not going to change.PureBasic compiles directly to x86, x86-64, PowerPC or 680x0 instruction sets, generating small standalone executables and DLLs which need no runtime libraries beyond the standard system libraries. Programs developed without using the platform-specific application programming interfaces (APIs) can be built easily from the same source file with little or no modification. PureBasic supports inline assembly, allowing the developer to include FASM assembler commands within PureBasic source code, while using the variables declared in PureBasic source code, enabling experienced programmers to improve the speed of speed-critical sections of code. PureBasic supports and has integrated the OGRE 3D Environment. Other 3D environments such as the Irrlicht Engine are unofficially supported. | https://en.wikipedia.org/wiki/PureBasic |
| Q | Pure, successor to the equational language Q, is a dynamically typed, functional programming language based on term rewriting. It has facilities for user-defined operator syntax, macros, arbitrary-precision arithmetic (multiple-precision numbers), and compiling to native code through the LLVM. Pure is free and open-source software distributed (mostly) under the GNU Lesser General Public License version 3 or later. Pure comes with an interpreter and debugger, provides automatic memory management, has powerful functional and symbolic programming abilities, and interfaces to libraries in C (e.g., for numerics, low-level protocols, and other such tasks). At the same time, Pure is a small language designed from scratch; its interpreter is not large, and the library modules are written in Pure. The syntax of Pure resembles that of Miranda and Haskell, but it is a free-format language and thus uses explicit delimiters (rather than off-side rule indents) to denote program structure. The Pure language is a successor of the equational programming language Q, previously created by the same author, Albert Gräf at the University of Mainz, Germany. Relative to Q, it offers some important new features (such as local functions with lexical scoping, efficient vector and matrix support, and the built-in C interface) and programs run much faster as they are compiled just-in-time to native code on the fly. Pure is mostly aimed at mathematical applications and scientific computing currently, but its interactive interpreter environment, the C interface and the growing set of addon modules make it suitable for a variety of other applications, such as artificial intelligence, symbolic computation, and real-time multimedia processing. Pure plug-ins are available for the Gnumeric spreadsheet and Miller Puckette's Pure Data graphical multimedia software, which make it possible to extend these programs with functions written in the Pure language. Interfaces are also provided as library modules to GNU Octave, OpenCV, OpenGL, the GNU Scientific Library, FAUST, SuperCollider, and liblo (for Open Sound Control (OSC)). | https://en.wikipedia.org/wiki/Q_(equational_programming_language) |
| Pure | Pure, successor to the equational language Q, is a dynamically typed, functional programming language based on term rewriting. It has facilities for user-defined operator syntax, macros, arbitrary-precision arithmetic (multiple-precision numbers), and compiling to native code through the LLVM. Pure is free and open-source software distributed (mostly) under the GNU Lesser General Public License version 3 or later. Pure comes with an interpreter and debugger, provides automatic memory management, has powerful functional and symbolic programming abilities, and interfaces to libraries in C (e.g., for numerics, low-level protocols, and other such tasks). At the same time, Pure is a small language designed from scratch; its interpreter is not large, and the library modules are written in Pure. The syntax of Pure resembles that of Miranda and Haskell, but it is a free-format language and thus uses explicit delimiters (rather than off-side rule indents) to denote program structure. The Pure language is a successor of the equational programming language Q created formerly by the same author, Albert Gräf at the University of Mainz, Germany. Relative to Q, it offers some important new features (such as local functions with lexical scoping, efficient vector and matrix support, and the built-in C interface) and programs run much faster as they are compiled just-in-time to native code on the fly. Pure is mostly aimed at mathematical applications and scientific computing currently, but its interactive interpreter environment, the C interface and the growing set of addon modules make it suitable for a variety of other applications, such as artificial intelligence, symbolic computation, and real-time multimedia processing. Pure plug-ins are available for the Gnumeric spreadsheet and Miller Puckette's Pure Data graphical multimedia software, which make it possible to extend these programs with functions written in the Pure language. Interfaces are also provided as library modules to GNU Octave, OpenCV, OpenGL, the GNU Scientific Library, FAUST, SuperCollider, and liblo (for Open Sound Control (OSC)). | https://en.wikipedia.org/wiki/Pure_(programming_language) |
| Pure Data | Pure Data (Pd) is a visual programming language developed by Miller Puckette in the 1990s for creating interactive computer music and multimedia works. While Puckette is the main author of the program, Pd is an open source project with a large developer base working on new extensions. It is released under a license similar to the BSD license. It runs on GNU/Linux, Mac OS X, iOS, Android and Windows. Ports exist for FreeBSD and IRIX. Pd is very similar in scope and design to Puckette's original Max program, developed while he was at IRCAM, and is to some degree interoperable with Max/MSP, the commercial successor to the Max language. They may be collectively discussed as members of the Patcher family of languages. With the addition of the Graphics Environment for Multimedia (GEM) external, and externals designed to work with it (like Pure Data Packet / PiDiP for Linux, Mac OS X), framestein for Windows, GridFlow (as n-dimensional matrix processing, for Linux, Mac OS X, Windows), it is possible to create and manipulate video, OpenGL graphics, images, etc., in realtime with extensive possibilities for interactivity with audio, external sensors, etc. Pd is natively designed to enable live collaboration across networks or the Internet, allowing musicians connected via LAN or even in disparate parts of the globe to create music together in real time. Pd uses FUDI as a networking protocol. | https://en.wikipedia.org/wiki/Pure_Data |
| Punycode | Punycode is a representation of Unicode with the limited ASCII character subset used for Internet hostnames. Using Punycode, host names containing Unicode characters are transcoded to a subset of ASCII consisting of letters, digits, and hyphens, which is called the Letter-Digit-Hyphen (LDH) subset. For example, München (German name for Munich) is encoded as Mnchen-3ya. While the Domain Name System (DNS) technically supports arbitrary sequences of octets in domain name labels, the DNS standards recommend the use of the LDH subset of ASCII conventionally used for host names, and require that string comparisons between DNS domain names should be case-insensitive. The Punycode syntax is a method of encoding strings containing Unicode characters, such as internationalized domain names (IDNA), into the LDH subset of ASCII favored by DNS. It is specified in IETF Request for Comments 3492. | https://en.wikipedia.org/wiki/Punycode |
| Punched tape | Punched tape or perforated paper tape is a form of data storage, consisting of a long strip of paper in which holes are punched to store data. Now effectively obsolete, it was widely used during much of the twentieth century for teleprinter communication, for input to computers of the 1950s and 1960s, and later as a storage medium for minicomputers and CNC machine tools. | https://en.wikipedia.org/wiki/Punched_tape |
| ProvideX | ProvideX is a computer language and development environment derived from Business Basic (a business oriented derivative of BASIC) in the mid-1980s. ProvideX is available on several operating systems (Unix/Linux/Windows/Mac OS X) and includes not only the programming language but also file system, presentation layer interface, and other components. The language is primarily designed for use in the development of business applications. Over the years since its inception and as the computer industry has changed, ProvideX has added functionality such as a graphical interface, client-server capabilities, access to external databases, web services, and, more recently, object-oriented programming capabilities. On October 8, 2010, PVX Plus Technologies announced that it has assumed all ongoing sales, development, and support of the ProvideX product line for Independent Software Vendors. This brings the development of the language back under control of the original creator, Mike King and is the end result of almost 2 years of negotiations between Sage, EDIAS, and PVX Plus Technologies. | https://en.wikipedia.org/wiki/ProvideX |
| Protocol Buffers | Protocol Buffers is a method of serializing structured data. It is useful in developing programs to communicate with each other over a wire or for storing data. The method involves an interface description language that describes the structure of some data and a program that generates source code from that description for generating or parsing a stream of bytes that represents the structured data. Google developed Protocol Buffers for use internally and has provided a code generator for multiple languages under an open source license (see below). The design goals for Protocol Buffers emphasized simplicity and performance. In particular, it was designed to be smaller and faster than XML. Protocol Buffers is widely used at Google for storing and interchanging all kinds of structured information. The method serves as a basis for a custom remote procedure call (RPC) system that is used for nearly all inter-machine communication at Google. Protocol Buffers are similar to the Apache Thrift (used by Facebook) or Microsoft Bond protocols, offering as well a concrete RPC protocol stack to use for defined services called gRPC. A software developer defines data structures (called messages) and services in a proto definition file (.proto) and compiles it with protoc. This compilation generates code that can be invoked by a sender or recipient of these data structures. For example, example.proto will produce example.pb.cc and example.pb.h, which will define C++ classes for each message and service that example.proto defines. Canonically, messages are serialized into a binary wire format which is compact, forward- and backward-compatible, but not self-describing (that is, there is no way to tell the names, meaning, or full datatypes of fields without an external specification). There is no defined way to include or refer to such an external specification (schema) within a Protocol Buffers file. The officially supported implementation includes an ASCII serialization format, but this format—though self-describing—loses the forward- and backward-compatibility behavior, and is thus not a good choice for applications other than debugging. Though the primary purpose of Protocol Buffers is to facilitate network communication, its simplicity and speed make Protocol Buffers an alternative to data-centric C++ classes and structs, especially where interoperability with other languages or systems might be needed in the future. | https://en.wikipedia.org/wiki/Protocol_Buffers |
| Proteus | Proteus (PROcessor for TExt Easy to USe) is a fully functional, procedural programming language created in 1998 by Simone Zanella. Proteus incorporates many functions derived from several other languages: C, BASIC, Assembly, Clipper/dBase; it is especially versatile in dealing with strings, having hundreds of dedicated functions; this makes it one of the richest languages for text manipulation. Proteus owes its name to a Greek god of the sea (Proteus), who took care of Neptune's crowd and gave responses; he was renowned for being able to transform himself, assuming different shapes. Transforming data from one form to another is the main usage of this language. | https://en.wikipedia.org/wiki/Proteus_%28programming_language%29 |
| Protel | Protel stands for "Procedure Oriented Type Enforcing Language". It is a programming language created by Nortel Networks and used on telecommunications switching systems such as the DMS-100. Protel-2 is the object-oriented version of Protel.PROTEL languages were designed to meet the needs of digital telephony and is the basis of the DMS-100 line of switching systems PROTEL is a strongly typed, block-structured language which is based heavily on PASCAL and ALGOL 68 with left-to-right style of variable assignment, variable-sized arrays, and extensible structures. The designers of PROTEL significantly extended PASCAL of the day by adding external compilation and extending the data structures available in the language. | https://en.wikipedia.org/wiki/Protel |
| Property Specification Language | Property Specification Language (PSL) is a temporal logic extending Linear temporal logic with a range of operators for both ease of expression and enhancement of expressive power. PSL makes an extensive use of regular expressions and syntactic sugaring. It is widely used in the hardware design and verification industry, where formal verification tools (such as model checking) and/or logic simulation tools are used to prove or refute that a given PSL formula holds on a given design. PSL was initially developed by Accellera for specifying properties or assertions about hardware designs. Since September 2004 the standardization on the language has been done in IEEE 1850 working group. In September 2005, the IEEE 1850 Standard for Property Specification Language (PSL) was announced. | https://en.wikipedia.org/wiki/Property_Specification_Language |
| Prolog | Prolog is a general-purpose logic programming language associated with artificial intelligence and computational linguistics. Prolog has its roots in first-order logic, a formal logic, and unlike many other programming languages, Prolog is intended as primarily a declarative programming language: the program logic is expressed in terms of relations, represented as facts and rules. A computation is initiated by running a query over these relations. The language was first conceived by a group around Alain Colmerauer in Marseille, France, in the early 1970s and the first Prolog system was developed in 1972 by Colmerauer with Philippe Roussel. Prolog was one of the first logic programming languages, and remains the most popular among such languages today, with several free and commercial implementations available. The language has been used for theorem proving, expert systems, term rewriting, type inference, and automated planning, as well as its original intended field of use, natural language processing. Modern Prolog environments support the creation of graphical user interfaces, as well as administrative and networked applications. Prolog is well-suited for specific tasks that benefit from rule-based logical queries such as searching databases, voice control systems, and filling templates. | https://en.wikipedia.org/wiki/Prolog |
| Project Jupyter | Project Jupyter ( ( listen)) is a nonprofit organization created to "develop open-source software, open-standards, and services for interactive computing across dozens of programming languages." Spun-off from IPython in 2014 by Fernando Pérez, Project Jupyter supports execution environments in several dozen languages. Project Jupyter's name is a reference to the three core programming languages supported by Jupyter, which are Julia, Python and R, and also an homage to Galileo's notebooks recording the discovery of the moons of Jupiter. Project Jupyter has developed and supported the interactive computing products Jupyter Notebook, Jupyter Hub, and Jupyter Lab, the next-generation version of Jupyter Notebook. | https://en.wikipedia.org/wiki/Project_Jupyter |
| Prograph | Prograph is a visual, object-oriented, dataflow, multiparadigm programming language that uses iconic symbols to represent actions to be taken on data. Commercial Prograph software development environments such as Prograph Classic and Prograph CPX were available for the Apple Macintosh and Windows platforms for many years but were eventually withdrawn from the market in the late 1990s. Support for the Prograph language on macOS has recently reappeared with the release of the Marten software development environment. | https://en.wikipedia.org/wiki/Prograph |
| DATABUS | Programming Language for Business or PL/B is a business-oriented programming language originally called DATABUS and designed by Datapoint in 1972[2] as an alternative to COBOL because Datapoint's 8-bit computers could not fit COBOL into their limited memory, and because COBOL did not at the time have facilities to deal with Datapoint's built-in keyboard and screen. | https://en.wikipedia.org/wiki/Programming_Language_for_Business |
| Programming Language for Business | Programming Language for Business or PL/B is a business-oriented programming language originally called DATABUS and designed by Datapoint in 1972 as an alternative to COBOL because Datapoint's 8-bit computers could not fit COBOL into their limited memory, and because COBOL did not at the time have facilities to deal with Datapoint's built-in keyboard and screen. A version of DATABUS became an ANSI standard, and the name PL/B came about when Datapoint chose not to release its trademark on the DATABUS name. | https://en.wikipedia.org/wiki/Programming_Language_for_Business |
| PILOT | Programmed Instruction, Learning, or Teaching (PILOT) is a simple programming language developed in the 1960s. Like its younger sibling LOGO, it was an early foray into the technology of computer-assisted instruction | https://en.wikipedia.org/wiki/PILOT |
| Processor Technology | Processor Technology Corporation was a personal computer company founded in April 1975 by Gary Ingram and Bob Marsh in Berkeley, California. Their first product was a 4K byte RAM board that was compatible with the MITS Altair 8800 computer but more reliable than the MITS board. This was followed by a series of memory and I/O boards including a video display module.Popular Electronics magazine wanted a feature article on an intelligent computer terminal and Technical Editor Les Solomon asked Marsh and Lee Felsenstein to design one. It was featured on the July 1976 cover and became the Sol-20 Personal Computer. The first units were shipped in December 1976 and the Sol-20 was a very successful product. The company failed to develop next generation products and ceased operations in May 1979. | https://en.wikipedia.org/wiki/Processor_Technology |
| Processing | Processing is an open source computer programming language and integrated development environment (IDE) built for the electronic arts, new media art, and visual design communities with the purpose of teaching the fundamentals of computer programming in a visual context, and to serve as the foundation for electronic sketchbooks. The project was initiated in 2001 by Casey Reas and Benjamin Fry, both formerly of the Aesthetics and Computation Group at the MIT Media Lab. In 2012, they started the Processing Foundation along with Daniel Shiffman, who joined as a third project lead. Johanna Hedva joined the Foundation in 2014 as Director of Advocacy. One of the aims of Processing is to allow non-programmers to start computer programming aided by visual feedback. The Processing language builds on the Java language, but uses a simplified syntax and a graphics user interface. | https://en.wikipedia.org/wiki/Processing_(programming_language) |
| ProbeVue | ProbeVue is IBM's implementation of a lightweight dynamic tracing environment introduced in AIX version 6.1. ProbeVue provides the ability to probe running processes in order to provide statistical analysis as well as retrieve data from the probed process. The dynamic nature of ProbeVue allows it to be used as a global system performance tool while retaining the ability to drill into very specific events on a single process or thread. Because modifications are not required of a probed process or system and the lightweight design of ProbeVue as a tracing tool, it is suitable for use in a production environment where previous tracing tools would have been performance prohibitive. | https://en.wikipedia.org/wiki/undefined |
| ProSet | ProSet is a set theoretic programming language that is being developed at the University of Essen as a successor to SETL. It is a very-high level language that supports prototyping. ProSet provides the following first-class data types: atom, integer, real, string, boolean, tuple, set. Functions and modules are also first-class. | https://en.wikipedia.org/wiki/ProSet |
| Apple ProDOS | ProDOS is the name of two similar operating systems for the Apple II series of personal computers. The original ProDOS, renamed ProDOS 8 in version 1.2, is the last official operating system usable by all 8-bit Apple II series computers, and was distributed from 1983 to 1993. The other, ProDOS 16, was a stop-gap solution for the 16-bit Apple IIGS that was replaced by GS/OS within two years.ProDOS was marketed by Apple as meaning Professional Disk Operating System, and became the most popular operating system for the Apple II series of computers 10 months after its release in January 1983. | https://en.wikipedia.org/wiki/Apple_ProDOS |
| Pro*C | Pro*C (also known as Pro*C/C++) is an embedded SQL programming language used by Oracle Database database management systems. Pro*C uses either C or C++ as its host language. During compilation, the embedded SQL statements are interpreted by a precompiler and replaced by C or C++ function calls to their respective SQL library. The output from the Pro*C precompiler is standard C or C++ code that is then compiled by any one of several C or C++ compilers into an executable. | https://en.wikipedia.org/wiki/Pro*C |
| PowerShell | PowerShell is a task automation and configuration management framework from Microsoft, consisting of a command-line shell and associated scripting language. Initially a Windows component only, known as Windows PowerShell, it was made open-source and cross-platform on 18 August 2016 with the introduction of PowerShell Core. The former is built on .NET Framework while the latter on .NET Core. In PowerShell, administrative tasks are generally performed by cmdlets (pronounced command-lets), which are specialized .NET classes implementing a particular operation. These work by accessing data in different data stores, like the file system or registry, which are made available to PowerShell via providers. Third-party developers can develop their own cmdlets and add them to PowerShell. Sets of cmdlets may be combined into scripts. PowerShell provides full access to COM and WMI, enabling administrators to perform administrative tasks on both local and remote Windows systems as well as WS-Management and CIM enabling management of remote Linux systems and network devices. PowerShell also provides a hosting API with which the PowerShell runtime can be embedded inside other applications. These applications can then use PowerShell functionality to implement certain operations, including those exposed via the graphical interface. This capability has been used by Microsoft Exchange Server 2007 to expose its management functionality as PowerShell cmdlets and providers and implement the graphical management tools as PowerShell hosts which invoke the necessary cmdlets. Other Microsoft applications including Microsoft SQL Server 2008 also expose their management interface via PowerShell cmdlets. PowerShell includes its own extensive, console-based help (similar to man pages in Unix shells) accessible via the Get-Help cmdlet. Local help contents can be retrieved from the Internet via Update-Help cmdlet. Alternatively, help from the web can be acquired on a case-by-case basis via the -online switch to Get-Help. | https://en.wikipedia.org/wiki/PowerShell |
| PowerPC | PowerPC (a backronym for Performance Optimization With Enhanced RISC – Performance Computing, sometimes abbreviated as PPC) is a reduced instruction set computer instruction set architecture created by the 1991 Apple–IBM–Motorola alliance, known as AIM. PowerPC, as an evolving instruction set, has since 2006 been named Power ISA, while the old name lives on as a trademark for some implementations of Power Architecture-based processors. PowerPC was the cornerstone of AIM's PReP and Common Hardware Reference Platform initiatives in the 1990s. Originally intended for personal computers, the architecture is well known for being used by Apple's Power Macintosh, PowerBook, iMac, iBook, and Xserve lines from 1994 until 2006, when Apple migrated to Intel's x86. It has since become niche in personal computers, but remain popular as embedded and high-performance processors. Its use in video game consoles and embedded applications provided an array of uses. In addition, PowerPC CPUs are still used in AmigaOne and third party AmigaOS 4 personal computers. PowerPC is largely based on IBM's earlier POWER instruction set architecture, and retains a high level of compatibility with it; the architectures have remained close enough that the same programs and operating systems will run on both if some care is taken in preparation; newer chips in the POWER series use the Power ISA. | https://en.wikipedia.org/wiki/PowerPC |
| PowerHouse | PowerHouse is a trademarked name for a byte-compiled fourth-generation programming language (or 4GL) originally produced by Quasar Corporation (later renamed Cognos Incorporated) for the Hewlett-Packard HP3000 mini-computer. It was initially composed of five components: QDD, or Quasar Data Dictionary: for building a central data dictionary used by all other components QDesign: a character-based screen generator Quick: an interactive, character-based screen processor (running screens generated by QDesign) Quiz: a report writer QTP: a batch transaction processor. | https://en.wikipedia.org/wiki/PowerHouse_%28programming_language%29 |
| PowerBuilder | PowerBuilder is an integrated development environment owned by SAP since the acquisition of Sybase in 2010. On July 5, 2016, SAP and Appeon entered into an agreement whereby Appeon would be responsible for developing, selling, and supporting PowerBuilder.PowerBuilder has been in use since 1991, peaking around 1998 with around 100,000 users. While PowerBuilder's market share has declined over the years, many applications created with it are still in use today. Over the years, PowerBuilder has been updated with new standards. In 2010, a major upgrade of PowerBuilder was released to provide support for the Microsoft .NET Framework. In 2014, support was added for OData, dockable windows, and 64-bit native applications. In 2017, support was added for iOS and Android app development.PowerBuilder 2018 provides new targets to enable developers to rapidly create RESTful Web APIs and non-visual .NET assemblies, in a test-driven manner, with the native PowerBuilder IDE and C#. A preview version is currently available for select customers. | https://en.wikipedia.org/wiki/PowerBuilder |
| Turbo Basic | PowerBASIC, formerly Turbo Basic, is the brand of several commercial compilers by PowerBASIC Inc. that compile a dialect of the BASIC programming language. There are both MS-DOS and Windows versions, and two kinds of the latter: Console and Windows. The MS-DOS version has a syntax similar to that of QBasic and QuickBASIC. The Windows versions use a BASIC syntax expanded to include many Windows functions, and the statements can be combined with calls to the Windows API. | https://en.wikipedia.org/wiki/Turbo_Basic |
| PowerBASIC | PowerBASIC, formerly Turbo Basic, is the brand of several commercial compilers by PowerBASIC Inc. that compile a dialect of the BASIC programming language. There are both MS-DOS and Windows versions, and two kinds of the latter: Console and Windows. The MS-DOS version has a syntax similar to that of QBasic and QuickBASIC. The Windows versions use a BASIC syntax expanded to include many Windows functions, and the statements can be combined with calls to the Windows API. | https://en.wikipedia.org/wiki/PowerBASIC |
| Power BI | Power BI is a business analytics service by Microsoft. It aims to provide interactive visualizations and business intelligence capabilities with an interface simple enough for end users to create their own reports and dashboards. | https://en.wikipedia.org/wiki/Power_BI |
| PostgreSQL | PostgreSQL, often simply Postgres, is an object-relational database management system (ORDBMS) with an emphasis on extensibility and standards compliance. As a database server, its primary functions are to store data securely and return that data in response to requests from other software applications. It can handle workloads ranging from small single-machine applications to large Internet-facing applications (or for data warehousing) with many concurrent users; on macOS Server, PostgreSQL is the default database; and it is also available for Microsoft Windows and Linux (supplied in most distributions). PostgreSQL is ACID-compliant and transactional. PostgreSQL has updatable views and materialized views, triggers, foreign keys; supports functions and stored procedures, and other expandability. PostgreSQL is developed by the PostgreSQL Global Development Group, a diverse group of many companies and individual contributors. It is free and open-source, released under the terms of the PostgreSQL License, a permissive software license. | https://en.wikipedia.org/wiki/PostgreSQL |
| PostScript | PostScript (PS) is a page description language in the electronic publishing and desktop publishing business. It is a dynamically typed, concatenative programming language and was created at Adobe Systems by John Warnock, Charles Geschke, Doug Brotz, Ed Taft and Bill Paxton from 1982 to 1984. | https://en.wikipedia.org/wiki/PostScript |
| Portable Standard Lisp | Portable Standard Lisp (PSL) is a tail-recursive dynamically bound dialect of Lisp inspired by its predecessor, Standard Lisp and the Portable Lisp Compiler. It was developed by researchers at the University of Utah in 1980, which released PSL 3.1; development was handed over to developers at Hewlett-Packard in 1982 who released PSL 3.3 and up. Portable Standard Lisp was available as a kit containing a screen editor, a compiler, and an interpreter for the 68000 processor architecture, DEC-20s, CRAY-1s, and the VAX architecture (among many others). Today, PSL is mainly developed by and available from Konrad-Zuse-Zentrum für Informationstechnik Berlin. Its main modern use is as underlying language for implementations of Reduce.Like most older lisps, PSL in the first step compiles Lisp to LAP code, which is a platform independent language in its own. However, where older lisps mostly compiled LAP directly to assembler or some architecture dependent intermediate, PSL compiles the LAP to C code, which would run in a virtual machine language; so programs written in it in principle are as portable as C itself, which is very portable. The compiler itself was written in PSL or a more primitive dialect dubbed "System Lisp"/"SYSLISP" as "an experiment in writing a production-quality Lisp in Lisp itself as much as possible, with only minor amounts of code written by hand in assembly language or other systems languages", so the whole ensemble could bootstrap itself, and improvements to the compiler improved the compiler itself as well. Some later releases had a compatibility package for Common Lisp, but this is not sustained in the modern versions. | https://en.wikipedia.org/wiki/Portable_Standard_Lisp |
| POPLOG | Poplog is a reflective, incrementally compiled software development environment for the programming languages POP-11, Common Lisp, Prolog, and Standard ML, originally created in the UK for teaching and research in artificial intelligence at the University of Sussex. | https://en.wikipedia.org/wiki/Poplog |
| Pnuts | Pnuts is a dynamic scripting language for the Java platform. It is designed to be used in a dual language system with the Java programming language. The goals of the Pnuts project are to provide a small, fast scripting language that has tight integration with the Java language. Pnuts uses syntax that is simple and friendly to Java developers, while also being very expressive. | https://en.wikipedia.org/wiki/Pnuts |
| Plus | Plus is a "Pascal-like" system implementation language from the University of British Columbia (UBC), Canada, based on the SUE system language developed at the University of Toronto, c. 1971.There is another programming language named PLUS, developed at Sperry Univac in Roseville, Minnesota, but the Univac PLUS is not the subject of this article. | https://en.wikipedia.org/wiki/Plus_(programming_language) |
| PLANNER | Planner (often seen in publications as "PLANNER" although it is not an acronym) is a programming language designed by Carl Hewitt at MIT, and first published in 1969. First, subsets such as Micro-Planner and Pico-Planner were implemented, and then essentially the whole language was implemented as Popler by Julian Davies at the University of Edinburgh in the POP-2 programming language. Derivations such as QA4, Conniver, QLISP and Ether (see Scientific Community Metaphor) were important tools in Artificial Intelligence research in the 1970s, which influenced commercial developments such as KEE and ART. | https://en.wikipedia.org/wiki/Planner_(programming_language) |
| Plankalkul | Plankalkül (German pronunciation: [ˈplaːnkalkyːl], "Plan Calculus") is a programming language designed for engineering purposes by Konrad Zuse between 1942 and 1945. It was the first high-level (non-von Neumann) programming language to be designed for a computer. "Kalkül" means formal system – the Hilbert-style deduction system is for example originally called "Hilbert-Kalkül", so Plankalkül means "formal system for planning". | https://en.wikipedia.org/wiki/Plankalkül |
| Pod | Plain Old Documentation (pod) is a lightweight markup language used to document the Perl programming language. | https://en.wikipedia.org/wiki/Plain_Old_Documentation |
| Pizza | Pizza is an open-source superset of Java 1.4, prior to the introduction of generics for the Java programming language. In addition to its own solution for adding generics to the language, Pizza also added function pointers and algebraic types with case classes and pattern matching. In August 2001, the developers made a compiler capable of working with Java. Most Pizza applications can run in a Java environment, but certain cases will cause problems. Work on Pizza has more or less stopped since 2002. Its main developers have concentrated instead on the Generic Java project, another attempt to add generics to Java which was eventually adopted into the official language version 1.5. The pattern matching and other functional programming-like features have been further developed in the Scala programming language. Martin Odersky remarked, "we wanted to integrate the functional and object-oriented parts in a cleaner way than what we were able to achieve before with the Pizza language. [...] In Pizza we did a clunkier attempt, and in Scala I think we achieved a much smoother integration between the two." | https://en.wikipedia.org/wiki/Pizza_(programming_language) |
| Pike | Pike is an interpreted, general-purpose, high-level, cross-platform, dynamic programming language, with a syntax similar to that of C. Unlike many other dynamic languages, Pike is both statically and dynamically typed, and requires explicit type definitions. It features a flexible type system that allows the rapid development and flexible code of dynamically typed languages, while still providing some of the benefits of a statically typed language. Pike features garbage collection, advanced data types, and first-class anonymous functions, with support for many programming paradigms, including object-oriented, functional and imperative programming. Pike is free software, released under the GPL, LGPL and MPL licenses. | https://en.wikipedia.org/wiki/Pike_(programming_language) |
| PICT | Pict is a statically typed programming language, one of the very few based on the π-calculus. Work on the language began at the University of Edinburgh in 1992, and development has been more or less dormant since 1998. The language is still at an experimental stage. | https://en.wikipedia.org/wiki/Pict_(programming_language) |
| PicoLisp | PicoLisp is an open source Lisp dialect. It runs on Linux and other POSIX-compliant systems. | https://en.wikipedia.org/wiki/PicoLisp |
| PhyloXML | PhyloXML is an XML language for the analysis, exchange, and storage of phylogenetic trees (or networks) and associated data. The structure of phyloXML is described by XML Schema Definition (XSD) language. A shortcoming of current formats for describing phylogenetic trees (such as Nexus and Newick/New Hampshire) is a lack of a standardized means to annotate tree nodes and branches with distinct data fields (which in the case of a basic species tree might be: species names, branch lengths, and possibly multiple support values). Data storage and exchange is even more cumbersome in studies in which trees are the result of a reconciliation of some kind: gene-function studies (requires annotation of nodes with taxonomic information as well as gene names, and possibly gene-duplication data) evolution of host-parasite interactions (requires annotation of tree nodes with taxonomic information for both host and parasite) phylogeographic studies (requires annotation of tree nodes with taxonomic and geographic information)To alleviate this, a variety of ad-hoc, special purpose formats have come into use (such as the NHX format, which focuses on the needs of gene-function and phylogenomic studies). A well defined XML format addresses these problems in a general and extensible manner and allows for interoperability between specialized and general purpose software. An example of a program for visualizing phyloXML is Archaeopteryx. | https://en.wikipedia.org/wiki/PhyloXML |
| Phoenix Object Basic | Phoenix Object Basic is an object-oriented rapid application development tool for Linux. It has object-oriented features such as inheritance and polymorphism as found in languages such as Python and Perl. It also features a similar design environment and compatible syntax to Visual Basic reducing the learning curve for those making a transition from that language to Linux programming. Phoenix includes a full implementation of the BASIC programming language. It was released for download in 2001 and the Linux package is at version 1.5 beta 6 (released October 2004), it also requires the distribution of a small number of runtime library files with complied applications. Phoenix Object Basic is a proprietary tool for cross-platform Linux and Windows application development. Key attributes: No longer being actively developed Rapid Application Development for Windows and Linux Short learning curve for VB developers Object-oriented Small executables, Fast execution Cross platform Released as an RPMThe Phoenix source code is not available because it contains proprietary third party components. Phoenix is free of charge and freely distributable. | https://en.wikipedia.org/wiki/Phoenix_Object_Basic |
| Pharo | Pharo is an open source dynamic and reflective language inspired from the programming language and integrated development environment (IDE) Smalltalk. Pharo offers strong live programming features such as immediate object manipulation, live update and hot recompiling. The live programming environment is at the heart of the system. | https://en.wikipedia.org/wiki/Pharo |
| Perl | Perl is a family of high-level, general-purpose, interpreted, dynamic programming languages. The languages in this family include Perl 5 and Perl 6. Though Perl is not officially an acronym, there are various backronyms in use, including "Practical Extraction and Reporting Language". Perl was originally developed by Larry Wall in 1987 as a general-purpose Unix scripting language to make report processing easier. Since then, it has undergone many changes and revisions. Perl 6, which began as a redesign of Perl 5 in 2000, eventually evolved into a separate language. Both languages continue to be developed independently by different development teams and liberally borrow ideas from one another. The Perl languages borrow features from other programming languages including C, shell script (sh), AWK, and sed. They provide powerful text processing facilities without the arbitrary data-length limits of many contemporary Unix commandline tools, facilitating easy manipulation of text files. Perl 5 gained widespread popularity in the late 1990s as a CGI scripting language, in part due to its then unsurpassed regular expression and string parsing abilities. In addition to CGI, Perl 5 is used for system administration, network programming, finance, bioinformatics, and other applications, such as for GUIs. It has been nicknamed "the Swiss Army chainsaw of scripting languages" because of its flexibility and power, and also its ugliness. In 1998, it was also referred to as the "duct tape that holds the Internet together", in reference to both its ubiquitous use as a glue language and its perceived inelegance. | https://en.wikipedia.org/wiki/Perl |
| Perl Data Language | Perl Data Language (abbreviated PDL) is a set of free software array programming extensions to the Perl programming language. PDL extends the data structures built into Perl, to include large multidimensional arrays, and adds functionality to manipulate those arrays as vector objects. It also provides tools for image processing, computer modeling of physical systems, and graphical plotting and presentation. Simple operations are automatically vectorized across complete arrays, and higher-dimensional operations (such as matrix multiplication) are supported. | https://en.wikipedia.org/wiki/Perl_Data_Language |
| PCRE | Perl Compatible Regular Expressions (PCRE) is a regular expression C library inspired by the regular expression capabilities in the Perl programming language. Philip Hazel started writing PCRE in summer 1997. PCRE's syntax is much more powerful and flexible than either of the POSIX regular expression flavors and than that of many other regular-expression libraries. While PCRE originally aimed at feature-equivalence with Perl, the two implementations are not fully equivalent. During the PCRE 7.x and Perl 5.9.x phase, the two projects have coordinated development, with features being ported between them in both directions. A number of prominent open-source programs, such as the Apache HTTP Server and the PHP and R scripting languages, incorporate the PCRE library; proprietary software can do likewise (BSD license). As of Perl 5.10, PCRE is also available as a replacement for Perl's default regular expression engine through the re::engine::PCRE module. The library can be built using configure and make (typical of Unix-like environments), as well as in Unix, Windows and other environments using CMake. Numerous default settings are chosen at build time. In addition to the PCRE library, the distribution includes a POSIX C wrapper, a native C++ wrapper, several test programs, and the utility program pcregrep built in tandem with the library. The PCRE library provides matching only; the C++ wrapper, if used, adds multiple match and replacement functionality. Unless users choose the "NoRecurse" PCRE build option (aka "--disable-stack-for-recursion"), the calling application or operating system must allocate adequate stack space to PCRE. The amount of stack needed varies for each pattern. For example, completing the tests provided with pcretest needs 8 MB of stack space. While PCRE's documentation cautions that the "NoRecurse" build option makes PCRE slower than the alternative, using it avoids entirely the issue of stack overflows. | https://en.wikipedia.org/wiki/Perl_Compatible_Regular_Expressions |
| Perl 6 | Perl 6 (also known as Raku) is a member of the Perl family of programming languages.While historically several interpreter and compiler implementations were being written, today only the Rakudo Perl 6 implementation is in active development. It is introducing elements of many modern and historical languages. Compatibility with Perl 5 is not a goal, though a compatibility mode is part of the specification. The design process for Perl 6 began in 2000. In February 2015 a post on The Perl Foundation blog stated that "The Perl6 team will attempt to get a development release of version 1.0 available for Larry's birthday in September and a Version 1.0 release by Christmas", and on 25 December 2015, the first stable version of the specification was announced.Development on Pugs, the first high-traction implementation, began in 2005, and there have been multiple Perl 6 implementation projects. Rakudo Perl 6 is based on NQP (Not Quite Perl) and can use MoarVM or the Java Virtual Machine as a runtime environment, and releases a new version every month (including precompiled GNU/Linux packages); in July 2010, the project released the first Rakudo Star distribution, a collection of a Perl 6 implementation and related materials. Larry Wall maintains a reference grammar known as STD.pm6, written in Perl 6 and bootstrapped with Perl 5. | https://en.wikipedia.org/wiki/Perl_6 |
| PeopleCode | PeopleCode is a proprietary object-oriented programming language used to express business logic for PeopleSoft applications. Syntactically, PeopleCode is similar to other programming languages, and can be found in both loosely-typed and strongly-typed forms. PeopleCode and its run-time environment is part of the larger PeopleTools framework. PeopleCode has evolved over time and its implementation through the PeopleSoft applications lack consistency. PeopleCode offers some interoperability with the Java programming language. Definition name references, for example, enable you to refer to PeopleTools definitions, such as record definitions or pages, without using hard-coded string literals. Other language features, such as PeopleCode data types and metastrings, reflect the close interaction of PeopleTools and Structured Query Language (SQL). Dot notation, classes and methods in PeopleCode are similar to other object oriented languages, like Java. Object syntax was an important feature of PeopleTools 8. | https://en.wikipedia.org/wiki/PeopleCode |
| PascalABC.NET | PascalABC.NET is a Pascal programming language that implements classic Pascal, most Delphi language features, as well as a number of their own extensions. It is implemented on the .NET Framework platform and contains all the modern language features: classes, operator overloading, interfaces, exception handling, generic classes and routines, garbage collection, lambda expressions, parallel programming tools (OpenMP only as of 2016). PascalABC.NET is also a simple and powerful integrated development environment with integrated debugger, IntelliSense system, form designer, code templates and code auto-formatting. Command-line PascalABC.NET compiler is also available on Linux and MacOS (under Mono).PascalABC.NET is popular in Russian schools and universities. In Southern Federal University, it is used as the main language for teaching students of Information technology in the course "Fundamentals of programming" and for teaching children in one of the largest computer schools in Russia. | https://en.wikipedia.org/wiki/PascalABC.NET |
| PASCAL/MT+ | Pascal/MT+ was an ISO 7185 compatible Pascal compiler written in 1980 by Michael Lehman, founder of MT MicroSYSTEMS of Solana Beach, California. The company was acquired by Digital Research in 1981 which subsequently distributed versions that ran on the 8080/Z80 processor under the CP/M operating system. Later versions ran on the 68000 CPU under CP/M-68K, and the 8086 CPU under CP/M-86 and MS-DOS. Pascal/MT+, for the 8086, was available for CP/M-86, PC DOS/MS-DOS as well as RMX-86 (a proprietary OS from Intel). Pascal/MT+86 still runs today on even the latest version of Microsoft Windows and DR-DOS. | https://en.wikipedia.org/wiki/Pascal/MT+ |
| Pascal | Pascal is an imperative and procedural programming language, which Niklaus Wirth designed in 1968–69 and published in 1970, as a small, efficient language intended to encourage good programming practices using structured programming and data structuring. It is named in honor of the French mathematician, philosopher and physicist Blaise Pascal. Pascal was developed on the pattern of the ALGOL 60 language. Wirth had already developed several improvements to this language as part of the ALGOL X proposals, but these were not accepted and Pascal was developed separately and released in 1970. A derivative known as Object Pascal designed for object-oriented programming was developed in 1985; this was used by Apple Computer and Borland in the late 1980s and later developed into Delphi on the Microsoft Windows platform. Extensions to the Pascal concepts led to the Pascal-like languages Modula-2 and Oberon. | https://en.wikipedia.org/wiki/Pascal_(programming_language) |
| Pascal Script | Pascal Script is a scripting language based on the programming language Pascal that facilitates automated runtime control over scriptable applications and server software. It is implemented by a free scripting engine that includes a compiler and an interpreter for byte code. Pascal Script supports the majority of Object Pascal constructs, making it partly compatible to Delphi, Free Pascal and GNU Pascal. Initially developed by Carlo Kok as CajScript and renamed to Innerfuse Pascal Script with version 2.23, the software was taken over by RemObjects, renamed again to RemObjects Pascal Script and offered as open source software for the Delphi IDE. Beginning with version 2.07 CajScript has been ported to Free Pascal. Since 2017 Pascal Script is included as a standard component in the Lazarus IDE. | https://en.wikipedia.org/wiki/Pascal_Script |
| Parser 3 | Parser is a free server-side CGI web scripting language developed by Art. Lebedev Studio and released under the GPL. Originally, Parser was merely a simple macro processing language. The latest 3rd revision (March 2006) introduced object-oriented programming features. The compiler for the language was developed in C++ by studio employees Konstantin Morshnev and Alexander Petrosyan to automate often repeated tasks, especially maintenance of already existing websites. It was used in many web projects of the studio. Since revision 3 it was released as free software and it is now used in other websites, mostly in Russia (according to a partial list at the language's website). The language supports technologies needed for common web design tasks: XML, Document Object Model (DOM), Perl Compatible Regular Expressions (PCRE) and others. | https://en.wikipedia.org/wiki/Parser_(CGI_language) |
| Parrot | Parrot is a register-based process virtual machine designed to run dynamic languages efficiently. It is possible to compile Parrot assembly language and PIR (an intermediate language) to Parrot bytecode and execute it. Parrot is free and open source software.Parrot was started by the Perl community and is developed with help from the open source and free software communities. As a result, it is focused on license compatibility with Perl (Artistic License 2.0), platform compatibility across a broad array of systems, processor architecture compatibility across most modern processors, speed of execution, small size (around 700k depending on platform), and the flexibility to handle the varying demands made by Perl 6 and other modern dynamic languages. Version 1.0, with a stable API for development, was released on March 17, 2009.The current version is release 8.1.0 "Andean Parakeet" | https://en.wikipedia.org/wiki/Parrot_virtual_machine |
| Parrot BASIC | Parrot is a register-based process virtual machine designed to run dynamic languages efficiently. It is possible to compile Parrot assembly language and PIR (an intermediate language) to Parrot bytecode and execute it. Parrot is free and open source software.Parrot was started by the Perl community and is developed with help from the open source and free software communities. As a result, it is focused on license compatibility with Perl (Artistic License 2.0), platform compatibility across a broad array of systems, processor architecture compatibility across most modern processors, speed of execution, small size (around 700k depending on platform), and the flexibility to handle the varying demands made by Perl 6 and other modern dynamic languages. Version 1.0, with a stable API for development, was released on March 17, 2009.The current version is release 8.1.0 "Andean Parakeet" | https://en.wikipedia.org/wiki/Parrot_BASIC |
| Parlog | Parlog is a logic programming language designed for efficient utilization of parallel computer architectures. Its semantics is based on first order predicate logic. It expresses concurrency, interprocess communication, indeterminacy and synchronization within the declarative language framework.It was designed at Imperial College, London by Steve Gregory and Keith L. Clark, as a descendant of IC Prolog and Relational Language. | https://en.wikipedia.org/wiki/Parlog |
| PTX | Parallel Thread Execution (PTX, or NVPTX) is a pseudo-assembly language used in Nvidia's CUDA programming environment. The nvcc compiler translates code written in CUDA, a C++-like language, into PTX, and the graphics driver contains a compiler which translates the PTX into a binary code which can be run on the processing cores. | https://en.wikipedia.org/wiki/Parallel_Thread_Execution |
| parasail | Parallel Specification and Implementation Language (ParaSail) is an object-oriented parallel programming language. Its design and ongoing implementation is described in a blog and on its official website. | https://en.wikipedia.org/wiki/ParaSail_(programming_language) |
| Papyrus | Papyrus is a material similar to thick paper that was used in ancient times as a writing surface. It was made from the pith of the papyrus plant, Cyperus papyrus, a wetland sedge. Papyrus (plural: papyri) can also refer to a document written on sheets of such material, joined together side by side and rolled up into a scroll, an early form of a book. Papyrus is first known to have been used in Egypt (at least as far back as the First Dynasty), as the papyrus plant was once abundant across the Nile Delta. It was also used throughout the Mediterranean region and in the Kingdom of Kush. Apart from a writing material, ancient Egyptians employed papyrus in the construction of other artifacts, such as reed boats, mats, rope, sandals, and baskets. | https://en.wikipedia.org/wiki/Papyrus |
| Pandoc | Pandoc is a free and open-source software document converter, widely used as a writing tool (especially by scholars) and as a basis for publishing workflows. It was created by John MacFarlane, a philosophy professor at the University of California, Berkeley. | https://en.wikipedia.org/wiki/Pandoc |
| PV-Wave | PV-WAVE (Precision Visuals - Workstation Analysis and Visualization Environment) is an array oriented fourth-generation programming language used by engineers, scientists, researchers, business analysts and software developers to build and deploy visual data analysis applications.. PV-WAVE was originally developed by a company called Precision Visuals, based in Boulder, CO. In 1992, the IMSL Numerical Libraries and Precision Visuals merged and the new company was renamed Visual Numerics. In 2009, Visual Numerics was acquired by Rogue Wave Software. PV-WAVE is closely related to the IDL (programming language), from whose code-base PV-WAVE originated. The shared history of PV-WAVE and IDL began in 1988, when Precision Visuals entered into an agreement with Research Systems, Incorporated (RSI, the original developer of IDL) under which Precision Visuals resold IDL under the name PV-WAVE. In September 1990, Precision Visuals exercised an option in its agreement with RSI to purchase a copy of the IDL source code. Since that time, IDL and PV-WAVE have been on separate development tracks: each product has been enhanced, supported, and maintained separately by its respective company.. Due to their common history, PV-WAVE and IDL share a similar FORTRAN-like syntax, as well as many common commands, functions, and subroutines. | https://en.wikipedia.org/wiki/PV-Wave |
| PS-algol | PS-algol is an orthogonally persistent programming language. PS-algol was an extension of the language S-algol implemented by the University of St Andrews and the University of Edinburgh, Scotland. S-algol was designed by Ron Morrison, and extended and by Pete Bailey, Fred Brown, Paul Cockshott, Ken Chisholm and Al Dearle. PS-algol was the world's first fully implemented persistent programming language, and had a significant quantity of users both in academia and, notably, in ICL research labs. | https://en.wikipedia.org/wiki/PS-algol |
| PROMAL | PROMAL (PROgrammer's Microapplication Language) is a structured programming language from Systems Management Associates for MS-DOS, Commodore 64, and Apple II. PROMAL features simple syntax, no line numbers, long variable names, functions and procedures with argument passing, real number type, arrays, strings, pointer, and a built-in I/O library. Like ABC and Python, indentation is part of the language syntax. The language uses a single-pass compiler to generate byte code that is interpreted when the program is run. Since the memory is very limited on these early home computers, the compiler can compile to/from disk and memory. The software package for C64 includes a full-screen editor and command shell. See also [Computer Language, Mar 1986, pp. 128–134]. | https://en.wikipedia.org/wiki/PROMAL |
| PROIV | PROIV is a low code development platform, developed and sold by NorthgateArinso, part of the Northgate Information Solutions Group. It has an active community of around 2500 developers and end-users worldwide, ranging from consultants to large multinationals, finance institutions, tax authorities, retailers, engineering companies, media operators and software houses. PROIV's usual application domain is database-centric business applications. PROIV has some similarities to languages such as ABAP, FOCUS and RPG. PROIV programs consist of declarative/non-procedural specifications that control the overall structure of the program and database access and that have an implicit sequence of execution (which PROIV programmers refer to as the timing cycle). Procedural subroutines can be added by the programmer; these are written in a 3GL-like language which PROIV calls "Logic". Note that in PROIV programs are referred to as "functions", which can be confusing as it differs from the more usual use of that term in programming languages. | https://en.wikipedia.org/wiki/PROIV |
| POP-2 | POP-2 (also referred to as POP2) is a programming language developed around 1970 from the earlier language POP-1 (developed by Robin Popplestone in 1968, originally named COWSEL) by Robin Popplestone and Rod Burstall at the University of Edinburgh. It drew roots from many sources: the languages LISP and ALGOL 60, and theoretical ideas from Peter J. Landin. It used an incremental compiler, which gave it some of the flexibility of an interpreted language, including allowing new function definitions at run time and modification of function definitions while a program was running (both of which are features of dynamic compilation), without the overhead of an interpreted language. | https://en.wikipedia.org/wiki/POP-2 |
| Pop-11 | POP-11 is a reflective, incrementally compiled programming language with many of the features of an interpreted language. It is the core language of the Poplog programming environment developed originally by the University of Sussex, and recently in the School of Computer Science at the University of Birmingham which hosts the Poplog website. POP-11 is an evolution of the language POP-2, developed in Edinburgh University and features an open stack model (like Forth, among others). It is mainly procedural, but supports declarative language constructs, including a pattern matcher and is mostly used for research and teaching in Artificial Intelligence, although it has features sufficient for many other classes of problems. It is often used to introduce symbolic programming techniques to programmers of more conventional languages like Pascal, who find POP syntax more familiar than that of Lisp. One of POP-11's features is that it supports first-class functions. Pop-11 is the core language of the Poplog system. The fact that the compiler and compiler subroutines are available at run-time (a requirement for incremental compilation) gives it the ability to support a far wider range of extensions than would be possible using only a macro facility. This made it possible for incremental compilers to be added for Prolog, Common Lisp and Standard ML, which could be added as required to support either mixed language development or development in the second language without using any Pop-11 constructs. This made it possible for Poplog to be used by teachers, researchers, or developers who were interested in only one of the languages. The most successful product developed in Pop-11 was the Clementine data-mining system, developed by ISL, as described in the entry on Poplog. After SPSS bought ISL they decided to port Clementine to C++ and Java, and eventually succeeded with great effort (and perhaps some loss of the flexibility provided by the use of an AI language!). As explained in the entries for Poplog and POP-2, Pop-11 was for a time available only as part of an expensive commercial package (Poplog), but since about 1999 it has been freely available as part of the Open Source version of Poplog, including various additional packages and teaching libraries. An online version of ELIZA using Pop-11 is available at Birmingham. At the University of Sussex David Young used Pop-11 in combination with C and Fortran to develop a suite of teaching and interactive development tools for image processing and vision, and has made them available in the Popvision extension to Poplog. | https://en.wikipedia.org/wiki/POP-11 |
| PLEXIL | PLEXIL (Plan Execution Interchange Language) is an open source technology for automation, created and currently in development by NASA. | https://en.wikipedia.org/wiki/PLEXIL |
| PLEX | PLEX (Programming Language for EXchanges) is a special-purpose, concurrent, real-time programming language. The PLEX language is closely tied to the architecture of Ericsson's AXE telephone exchanges which it was designed to control. PLEX was developed by Göran Hemdahl at Ericsson in the 1970s, and it has been continuously evolving since then. PLEX was described in 2008 as "a cross between Fortran and a macro assembler."The language has two variants: Plex-C used for the AXE Central Processor (CP) and Plex-M used for Extension Module Regional Processors (EMRP). | https://en.wikipedia.org/wiki/PLEX_(programming_language) |
| PL360 | PL360 (or PL/360) is a programming language designed by Niklaus Wirth and written by Niklaus Wirth, Joseph W. Wells, Jr., and Edwin Satterthwaite, Jr. for the IBM System/360 computer at Stanford University. A description of PL360 was published in early 1968, although the implementation was probably completed before Wirth left Stanford in 1967. | https://en.wikipedia.org/wiki/PL360 |
| PL/pgSQL | PL/pgSQL (Procedural Language/PostgreSQL) is a procedural programming language supported by the PostgreSQL ORDBMS. It closely resembles Oracle's PL/SQL language. Implemented by Jan Wieck, PL/pgSQL first appeared with PostgreSQL 6.4, released on October 30, 1998. Version 9 also implements some ISO SQL/PSM features, like overloading of SQL-invoked functions and procedures.PL/pgSQL, as a fully featured programming language, allows much more procedural control than SQL, including the ability to use loops and other control structures. SQL statements and triggers can call functions created in the PL/pgSQL language. The design of PL/pgSQL aimed to allow PostgreSQL users to perform more complex operations and computations than SQL, while providing ease of use. The language is able to be defined as trusted by the server.PL/pgSQL is one of the programming languages included in the standard PostgreSQL distribution, the others being PL/Tcl, PL/Perl and PL/Python. In addition many others are available from third parties, including PL/Java, PL/pgPSM, PL/php, PL/R, PL/Ruby,PL/sh, PL/Lua and PL/v8. PostgreSQL uses Bison as its parser, making it easy to port many open-source languages, as well as to reuse code. | https://en.wikipedia.org/wiki/PL/pgSQL |
| PL/SQL | PL/SQL (Procedural Language/Structured Query Language) is Oracle Corporation's procedural extension for SQL and the Oracle relational database. PL/SQL is available in Oracle Database (since version 6 - stored pl/sql procedures/functions/packages/triggers since version 7), TimesTen in-memory database (since version 11.2.1), and IBM DB2 (since version 9.7). Oracle Corporation usually extends PL/SQL functionality with each successive release of the Oracle Database. PL/SQL includes procedural language elements such as conditions and loops. It allows declaration of constants and variables, procedures and functions, types and variables of those types, and triggers. It can handle exceptions (runtime errors). Arrays are supported involving the use of PL/SQL collections. Implementations from version 8 of Oracle Database onwards have included features associated with object-orientation. One can create PL/SQL units such as procedures, functions, packages, types, and triggers, which are stored in the database for reuse by applications that use any of the Oracle Database programmatic interfaces. | https://en.wikipedia.org/wiki/PL/SQL |
| PL/I | PL/I (Programming Language One, pronounced ) is a procedural, imperative computer programming language designed for scientific, engineering, business and system programming uses. It has been used by various academic, commercial and industrial organizations since it was introduced in the 1960s, and continues to be actively used. PL/I's main domains are data processing, numerical computation, scientific computing, and system programming; it supports recursion, structured programming, linked data structure handling, fixed-point, floating-point, complex, character string handling, and bit string handling. The language syntax is English-like and suited for describing complex data formats, with a wide set of functions available to verify and manipulate them. | https://en.wikipedia.org/wiki/PL/I |
| PL/C | PL/C is a computer programming language developed at Cornell University with the specific goal of being used for teaching programming. It is based on IBM's PL/I language, and was designed in the early 1970s. Cornell also developed a compiler for the language that was based on its earlier CUPL compiler, and it was widely used in college-level programming courses. The two researchers and academic teachers who designed PL/C were Richard W. Conway and Thomas R. Wilcox. They submitted the famous article "Design and implementation of a diagnostic compiler for PL/I" published in the Communications of ACM in March 1973, pages 169-179. PL/C eliminated some of the more complex features of PL/I, and added extensive debugging and error recovery facilities. PL/C is a subset of PL/I. A program that runs without error under the PL/C compiler should run under PL/I and produce the same results, unless certain incompatible diagnostic features, such as a macro section (begun by a $MACRO statement and finished by a $MEND statement), were used.The PL/C compiler had the unusual capability of never failing to compile any program, through the use of extensive automatic correction of many syntax errors and by converting any remaining syntax errors to output statements. | https://en.wikipedia.org/wiki/PL/C |
| PL/0 | PL/0 is a programming language, intended as an educational programming language, that is similar to but much simpler than Pascal, a general-purpose programming language. It serves as an example of how to construct a compiler. It was originally introduced in the book, Algorithms + Data Structures = Programs, by Niklaus Wirth in 1976. It features quite limited language constructs: there are no real numbers, very few basic arithmetic operations and no control-flow constructs other than "if" and "while" blocks. While these limitations make writing real applications in this language impractical, it helps the compiler remain compact and simple. | https://en.wikipedia.org/wiki/PL/0 |
| PL-11 | PL-11 is a high-level machine-oriented programming language for the PDP-11, developed by R.D. Russell of CERN in 1971. Written in Fortran IV, it is similar to PL360 and is cross-compiled on other machines. PL-11 was originally developed as part of the Omega project, a particle physics facility operational at CERN (Geneva, Switzerland) during the 1970s. The first version was written for the CII 10070, a clone of the XDS Sigma 7 built in France. Towards the end of the 1970s it was ported to the IBM 370/168, then part of CERN's computer centre. A report describing the language is available from CERN. | https://en.wikipedia.org/wiki/PL-11 |
| PIKT | PIKT is cross-categorical, multi-purpose software for global-view, site-at-a-time system and network administration. Applicability includes system monitoring, configuration management, server and network administration, system security, and many other uses. PIKT consists of a feature-rich file preprocessor; a scripting language; a flexible, centrally directed process scheduler; a customizing file installer; a collection of command-line extensions; and other useful tools. The PIKT binaries are written using a combination of C, lex (flex), and yacc (bison). PIKT's configuration combines free-form text files, Pikt scripts, and programs written in other popular scripting languages. PIKT is in widespread use at thousands of sites around the world, although its popularity is diminished by the perception that it is complicated to set up and difficult to administer. Recent changes have mitigated the complexity and difficulty somewhat. PIKT's user community is low-profile and not very active. PIKT was first released publicly on October 17, 1998, and has undergone numerous revisions since then. As of 2008, it is still being actively maintained. | https://web.archive.org/web/20190328003724/https://en.wikipedia.org/wiki/PIKT |
| PIC microcontroller | PIC (usually pronounced as "pick") is a family of microcontrollers made by Microchip Technology, derived from the PIC1650 originally developed by General Instrument's Microelectronics Division. The name PIC initially referred to Peripheral Interface Controller, then it was corrected as Programmable Intelligent Computer. The first parts of the family were available in 1976; by 2013 the company had shipped more than twelve billion individual parts, used in a wide variety of embedded systems. Early models of PIC had read-only memory (ROM) or field-programmable EPROM for program storage, some with provision for erasing memory. All current models use flash memory for program storage, and newer models allow the PIC to reprogram itself. Program memory and data memory are separated. Data memory is 8-bit, 16-bit, and, in latest models, 32-bit wide. Program instructions vary in bit-count by family of PIC, and may be 12, 14, 16, or 24 bits long. The instruction set also varies by model, with more powerful chips adding instructions for digital signal processing functions. The hardware capabilities of PIC devices range from 6-pin SMD, 8-pin DIP chips up to 144-pin SMD chips, with discrete I/O pins, ADC and DAC modules, and communications ports such as UART, I2C, CAN, and even USB. Low-power and high-speed variations exist for many types. The manufacturer supplies computer software for development known as MPLAB X, assemblers and C/C++ compilers, and programmer/debugger hardware under the MPLAB and PICKit series. Third party and some open-source tools are also available. Some parts have in-circuit programming capability; low-cost development programmers are available as well as high-production programmers. PIC devices are popular with both industrial developers and hobbyists due to their low cost, wide availability, large user base, extensive collection of application notes, availability of low cost or free development tools, serial programming, and re-programmable Flash-memory capability. | https://en.wikipedia.org/wiki/PIC_microcontroller |
| PHP | PHP is a server-side scripting language designed primarily for web development but also used as a general-purpose programming language. Originally created by Rasmus Lerdorf in 1994, the PHP reference implementation is now produced by The PHP Development Team. PHP originally stood for Personal Home Page, but it now stands for the recursive acronym PHP: Hypertext Preprocessor. PHP code may be embedded into HTML or HTML5 markup, or it can be used in combination with various web template systems, web content management systems and web frameworks. PHP code is usually processed by a PHP interpreter implemented as a module in the web server or as a Common Gateway Interface (CGI) executable. The web server software combines the results of the interpreted and executed PHP code, which may be any type of data, including images, with the generated web page. PHP code may also be executed with a command-line interface (CLI) and can be used to implement standalone graphical applications. The standard PHP interpreter, powered by the Zend Engine, is free software released under the PHP License. PHP has been widely ported and can be deployed on most web servers on almost every operating system and platform, free of charge. The PHP language evolved without a written formal specification or standard until 2014, leaving the canonical PHP interpreter as a de facto standard. Since 2014 work has gone on to create a formal PHP specification. | https://en.wikipedia.org/wiki/PHP |
| PEARL | PEARL, or Process and experiment automation realtime language, is a computer programming language designed for multitasking and real-time programming. Being a high-level language, it is fairly cross-platform. Since 1977, the language has been going under several standardization steps by the Deutsches Institut für Normung. The current version is PEARL-90, which was standardized in 1998 as DIN 66253-2. PEARL is not to be confused with the similarly named Perl, an entirely unrelated programming language created by Larry Wall in 1987. | https://en.wikipedia.org/wiki/PEARL_(programming_language) |
| PBASIC | PBASIC is a microcontroller-based version of BASIC created by Parallax, Inc. in 1992.PBASIC was created to bring ease of use to the microcontroller and embedded processor world. It is used for writing code for the BASIC Stamp microcontrollers. After the code is written, it is tokenized and loaded into an EEPROM on the microcontroller. These tokens are fetched by the microcontroller and used to generate instructions for the processor. | https://en.wikipedia.org/wiki/PBASIC |
| PARI/GP | PARI/GP is a computer algebra system with the main aim of facilitating number theory computations. Versions 2.1.0 and higher are distributed under the GNU General Public License. It runs on most common operating systems. | https://en.wikipedia.org/wiki/PARI/GP |
| PALASM | PALASM is an early hardware description language, used to translate Boolean functions and state transition tables into a fuse map for use with Programmable Array Logic (PAL) devices introduced by Monolithic Memories, Inc. (MMI). The language was developed by John Birkner in the early 1980s. It is not case-sensitive. The PALASM compiler was written by MMI in FORTRAN IV on an IBM 370/168. MMI made the source code available to users at no cost. By 1983, MMI customers ran versions on the DEC PDP-11, Data General NOVA, Hewlett-Packard HP 2100, MDS800 and others. A widely used MS DOS port was produced by MMI. There was a windows front-end written sometime later. | https://en.wikipedia.org/wiki/PALASM |
| PACT I | PACT was a series of compilers for the IBM 701 and IBM 704 scientific computers. Their development was conducted jointly by IBM and a committee of customers starting in 1954. PACT I was developed for the 701, and PACT IA for the 704. The emphasis in that early generation of compilers was minimization of the memory footprint, because memory was a very expensive resource at the time. The word "compiler" was not in widespread use at the time, so most of the 1956 papers described it as an "(automatic) coding system", although the word compiler was also used in some papers. | https://en.wikipedia.org/wiki/PACT_I |
| P4 | P4 is a programming language designed to allow programming of packet forwarding planes. In contrast to a general purpose language such as C or Python, P4 is a domain-specific language with a number of constructs optimized around network data forwarding. P4 is an open-source, permissively licensed language and is maintained by a non-profit organization called the P4 Language Consortium. The language was originally described in a SIGCOMM CCR paper in 2014 titled “Programming Protocol-Independent Packet Processors” – the alliterative name shortens to “P4”. | https://en.wikipedia.org/wiki/P4_(programming_language) |
| Oz | Oz is a multiparadigm programming language, developed in the Programming Systems Lab at Université catholique de Louvain, for programming language education. It has a canonical textbook: Concepts, Techniques, and Models of Computer Programming. Oz was first designed by Gert Smolka and his students in 1991. In 1996, development of Oz continued in cooperation with the research group of Seif Haridi and Peter Van Roy at the Swedish Institute of Computer Science. Since 1999, Oz has been continually developed by an international group, the Mozart Consortium, which originally consisted of Saarland University, the Swedish Institute of Computer Science, and the Université catholique de Louvain. In 2005, the responsibility for managing Mozart development was transferred to a core group, the Mozart Board, with the express purpose of opening Mozart development to a larger community. The Mozart Programming System is the primary implementation of Oz. It is released with an open source license by the Mozart Consortium. Mozart has been ported to different flavors of Unix, FreeBSD, Linux, Windows, and macOS. | https://en.wikipedia.org/wiki/Oz_(programming_language) |
| Oxygene | Oxygene (formerly known as Chrome) is a programming language developed by RemObjects Software for Microsoft's Common Language Infrastructure, the Java Platform and Cocoa. Oxygene is Object Pascal-based, but also has influences from C#, Eiffel, Java, F# and other languages. Compared to the now deprecated Delphi.NET, Oxygene does not emphasize total backward compatibility, but is designed to be a "reinvention" of the language, be a good citizen on the managed development platforms, and leverage all the features and technologies provided by the .NET and Java runtimes. Oxygene is commercial product, and offers full integration into Microsoft's Visual Studio IDE on Windows, as well as its own IDE, Fire for use on macOS. The command line compiler is available free. Oxygene is one of three languages supported by the underlying Elements Compiler toolchain, next to C# and Swift. From 2008 to 2012, RemObjects Software has licensed its compiler and IDE technology to Embarcadero to be used in their Embarcadero Prism product. Starting in the Fall of 2011, Oxygene became available in two separate editions, with the second edition adding support for the Java and Android runtimes. Starting with the release of XE4, Embarcadero Prism is no longer part of the RAD Studio SKU. Numerous support and upgrade paths for Prism customers exist to migrate to Oxygene. As of 2016, there is only one edition of Oxygene, which allows development on Windows or macOS, and which can create executables for Windows .NET, iOS, Android, Java and macOS. | https://en.wikipedia.org/wiki/Oxygene_(programming_language) |
| Chrome | Oxygene (formerly known as Chrome) is a programming language developed by RemObjects Software for Microsoft's Common Language Infrastructure, the Java Platform and Cocoa. Oxygene is Object Pascal-based, but also has influences from C#, Eiffel, Java, F# and other languages. Compared to the now deprecated Delphi.NET, Oxygene does not emphasize total backward compatibility, but is designed to be a "reinvention" of the language, be a good citizen on the managed development platforms, and leverage all the features and technologies provided by the .NET and Java runtimes. Oxygene is a commercial product, and offers full integration into Microsoft's Visual Studio IDE on Windows, as well as its own IDE, Fire for use on macOS. The command line compiler is available free. Oxygene is one of four languages supported by the underlying Elements Compiler toolchain, next to C#, Swift and Java). From 2008 to 2012, RemObjects Software has licensed its compiler and IDE technology to Embarcadero to be used in their Embarcadero Prism product. Starting in the Fall of 2011, Oxygene became available in two separate editions, with the second edition adding support for the Java and Android runtimes. Starting with the release of XE4, Embarcadero Prism is no longer part of the RAD Studio SKU. Numerous support and upgrade paths for Prism customers exist to migrate to Oxygene. As of 2016, there is only one edition of Oxygene, which allows development on Windows or macOS, and which can create executables for Windows .NET, iOS, Android, Java and macOS. | https://en.wikipedia.org/wiki/Chrome_%28programming_language%29 |
| OX | Ox is an object-oriented matrix programming language with a mathematical and statistical function library, developed by Jurgen Doornik. It has been designed for econometric programming. It is available for Windows, Mac OS X and Linux platforms. The downloadable console version of Ox is free for academic use. A commercial version is available for non-academic use. According to its documentation, it should be cited whenever results are published.The programming environment for econometric modelling OxMetrics is based on Ox. | https://en.wikipedia.org/wiki/Ox_(programming_language) |
| Org | Org-mode (also: Org mode; ) is a document editing, formatting, and organizing mode, designed for notes, planning, and authoring within the free software text editor Emacs. The name is used to encompass plain text files ("org files") that include simple marks to indicate levels of a hierarchy (such as the outline of an essay, a topic list with subtopics, nested computer code, etc.), and an editor with functions that can read the markup and manipulate hierarchy elements (expand/hide elements, move blocks of elements, check off to-do list items, etc.). Org-mode was created by Carsten Dominik in 2003, originally to organize his own life and work, and since the first release numerous other users and developers have contributed to this free software package. Emacs includes Org-mode as a major mode by default. Bastien Guerry is the current maintainer, in cooperation with an active development community. Since its success in Emacs, some other systems have also begun providing functions to work with org files. | https://en.wikipedia.org/wiki/Org-mode |
| Orc | Orc is a concurrent, nondeterministic computer programming language created by Jayadev Misra at the University of Texas at Austin. Orc provides uniform access to computational services, including distributed communication and data manipulation, through sites. Using four simple concurrency primitives, the programmer orchestrates the invocation of sites to achieve a goal, while managing timeouts, priorities, and failures. | https://en.wikipedia.org/wiki/Orc_(programming_language) |
| Optimized Systems Software | Optimized Systems Software (OSS) was a company that produced disk operating systems, programming languages, and applications primarily for the Atari 8-bit family of home computers, but some products were also sold for the Apple II. OSS was best known for their enhanced versions of Atari BASIC and the MAC/65 assembler (both of which are much faster than Atari's products) and the Action! programming language. OSS transitioned to other platforms with Personal Pascal for the Atari ST and Personal Prolog for Macintosh (which was also advertised for the Atari ST, but may not have been released). OSS was not as significant in those markets. | https://en.wikipedia.org/wiki/Optimized_Systems_Software |
| OptimJ | OptimJ is an extension of the Java with language support for writing optimization models and abstractions for bulk data processing. The extensions and the proprietary product implementing the extensions were developed by Ateji which went out of business in September 2011. OptimJ aims at providing a clear and concise algebraic notation for optimization modeling, removing compatibility barriers between optimization modeling and application programming tools, and bringing software engineering techniques such as object-orientation and modern IDE support to optimization experts. OptimJ models are directly compatible with Java source code, existing Java libraries such as database access, Excel connection or graphical interfaces. OptimJ is compatible with development tools such as Eclipse, CVS, JUnit or JavaDoc. OptimJ is available free with the following solvers: lp_solve, glpk, LP or MPS file formats and also supports the following commercial solvers: Gurobi, MOSEK, IBM ILOG CPLEX Optimization Studio. | https://en.wikipedia.org/wiki/OptimJ |
| Operational Control Language | Operational Control Language (OCL) is the control language of the IBM System/34 and System/36 minicomputer family. Other control languages include CL (System/38 and AS/400), JCL (System/370), and REXX (AS/400). The facility of DOS to use batch files is also control language. | https://en.wikipedia.org/wiki/Operational_Control_Language |
| OpenVera | OpenVera is a hardware verification language developed and managed by Synopsys. OpenVera is an interoperable, open hardware verification language for testbench creation. The OpenVera language was used as the basis for the advanced verification features in the IEEE Std. 1800 SystemVerilog standard, for the benefit of the entire verification community including companies in the semiconductor, systems, IP and EDA industries along with verification services. The OpenVera language reference manual (LRM) can be obtained at no cost, but modifications to the language must go through Synopsys. | https://en.wikipedia.org/wiki/OpenVera |
| OpenSCAD | OpenSCAD is a free software application for creating solid 3D CAD (computer-aided design) objects. It is a script-only based modeller that uses its own description language; parts can be previewed, but it cannot be interactively selected or modified by mouse in the 3D view. An OpenSCAD script specifies geometric primitives (such as spheres, boxes, cylinders, etc.) and defines how they are modified and combined (for instance by intersection, difference, envelope combination and Minkowski sums) to render a 3D model. As such, the program does constructive solid geometry (CSG). OpenSCAD is available for Windows, Linux and OS X. | https://en.wikipedia.org/wiki/OpenSCAD |
| OpenROAD | OpenROAD stands for "Open Rapid Object Application Development". It is a software product of Actian Corporation. OpenROAD is a fourth-generation programming language (4GL) which include a suite of development tools, with built-in Integrated development environment (IDE) (Written in OpenROAD), Code Repository, allowing applications to be developed and deployed on Microsoft and UNIX/LINUX platforms. | https://en.wikipedia.org/wiki/OpenROAD |
| StarOffice Basic | OpenOffice Basic (formerly known as StarOffice Basic or StarBasic or OOoBasic) is a dialect of the programming language BASIC that originated with the StarOffice office suite and spread through OpenOffice.org and derivatives such as LibreOffice (where it is known as LibreOffice Basic). The language is a domain-specific programming language which specifically serves the OpenOffice application suite. | https://en.wikipedia.org/wiki/StarOffice_Basic |
| OpenNN | OpenNN (Open Neural Networks Library) is a software library written in the C++ programming language which implements neural networks, a main area of deep learning research. | https://en.wikipedia.org/wiki/OpenNN |
| OpenLisp | OpenLisp is a programming language in the Lisp family developed by Christian Jullien. It conforms to the international standard for ISLISP published jointly by the International Organization for Standardization (ISO) and International Electrotechnical Commission (IEC), ISO/IEC 13816:1997(E), revised to ISO/IEC 13816:2007(E).Written in the programming languages C and Lisp, it runs on most common operating systems. OpenLisp is designated an ISLISP implementation, but also contains many Common Lisp-compatible extensions (hashtable, readtable, package, defstruct, sequences, rational numbers) and other libraries (network socket, regular expression, XML, Portable Operating System Interface (POSIX), SQL, Lightweight Directory Access Protocol (LDAP)).OpenLisp includes an interpreter associated to a read–eval–print loop (REPL), a Lisp Assembly Program (LAP) and a backend compiler for the language C. | https://en.wikipedia.org/wiki/OpenLisp |
| GLSL | OpenGL Shading Language (abbreviated: GLSL), is a high-level shading language with a syntax based on the C programming language. It was created by the OpenGL ARB (OpenGL Architecture Review Board) to give developers more direct control of the graphics pipeline without having to use ARB assembly language or hardware-specific languages. | https://en.wikipedia.org/wiki/OpenGL_Shading_Language |
| OpenEdge ABL | OpenEdge Advanced Business Language, or OpenEdge ABL for short, is a business application development language created and maintained by Progress Software Corporation (PSC). The language, typically classified as a fourth-generation programming language, uses an English-like syntax to simplify software development. The language was called PROGRESS or Progress 4GL up until version 9, but in 2006 PSC changed the name to OpenEdge Advanced Business Language (OpenEdge ABL) in order to overcome a presumed industry perception that 4GLs were less capable than other languages. A subset of the language, called SpeedScript, is used in the development of web applications.OpenEdge ABL helps developers to develop applications optionally using its own integrated relational database and programming tool. These applications are portable across computing systems and allow access to various popular data sources without having to learn the underlying data access methods. This means that the end-user of these products can be unaware of the underlying architecture. By combining a fourth generation language and relational database, OpenEdge ABL allows the use of the Rapid Application Development (RAD) model for developing software. A programmer and even end users can do rapid prototyping using the integrated and GUI tools of the development environment. | https://en.wikipedia.org/wiki/OpenEdge_Advanced_Business_Language |
| OpenEXR | OpenEXR is a high dynamic range raster file format, released as an open standard along with a set of software tools created by Industrial Light & Magic (ILM), under a free software license similar to the BSD license.It is notable for supporting multiple channels of potentially different pixel sizes, including 64-, 32- and 16-bit floating point values, as well as various compression techniques which include lossless and lossy compression algorithms. It also has arbitrary channels and encodes multiple points of view such as left- and right-camera images. | https://en.wikipedia.org/wiki/OpenEXR |
| Open Shading Language | Open Shading Language (OSL) is a shading language developed by Sony Pictures Imageworks for use in its Arnold Renderer. It is also supported by Otoy's Octane Render, V-Ray 3, and by the Cycles render engine in Blender (starting with Blender 2.65). OSL's surface and volume shaders define how surfaces or volumes scatter light in a way that allows for importance sampling; thus, it is well suited for physically-based renderers that support ray tracing and global illumination. | https://en.wikipedia.org/wiki/Open_Shading_Language |
| OPL | Open Programming Language (OPL) is an embedded programming language for portable devices that run the Symbian Operating System. | https://en.wikipedia.org/wiki/Open_Programming_Language |
| OpenGL | Open Graphics Library (OpenGL) is a cross-language, cross-platform application programming interface (API) for rendering 2D and 3D vector graphics. The API is typically used to interact with a graphics processing unit (GPU), to achieve hardware-accelerated rendering. Silicon Graphics Inc., (SGI) started developing OpenGL in 1991 and released it in January 1992; applications use it extensively in the fields of computer-aided design (CAD), virtual reality, scientific visualization, information visualization, flight simulation, and video games. Since 2006 OpenGL has been managed by the non-profit technology consortium Khronos Group. | https://en.wikipedia.org/wiki/OpenGL |
| OpenCL | Open Computing Language (OpenCL) is a framework for writing programs that execute across heterogeneous platforms consisting of central processing units (CPUs), graphics processing units (GPUs), digital signal processors (DSPs), field-programmable gate arrays (FPGAs) and other processors or hardware accelerators. OpenCL specifies programming languages (based on C99 and C++11) for programming these devices and application programming interfaces (APIs) to control the platform and execute programs on the compute devices. OpenCL provides a standard interface for parallel computing using task- and data-based parallelism. OpenCL is an open standard maintained by the non-profit technology consortium Khronos Group. Conformant implementations are available from Altera, AMD, Apple, ARM, Creative, IBM, Imagination, Intel, Nvidia, Qualcomm, Samsung, Vivante, Xilinx, and ZiiLABS. | https://en.wikipedia.org/wiki/OpenCL |
| Opa | Opa is an open-source programming language for developing scalable web applications. It can be used for both client-side and server-side scripting, where complete programs are written in Opa and subsequently compiled to Nodejs on the server and JavaScript on the client, with the compiler automating all communication between the two. Opa implements strong, static typing, which can be helpful in protecting against security issues such as SQL injections and cross-site scripting attacks. The language was first officially presented at the OWASP conference in 2010, and the source code was released on GitHub in June 2011, under a GNU Affero General Public License. Later, the license changed to the MIT license for the framework part (library) and AGPL for the compiler so that applications written in Opa can be released under any license, proprietary or open source. | https://en.wikipedia.org/wiki/Opa_(programming_language) |
| Onyx | Onyx is a stack-oriented, multi-threaded, interpreted, general purpose programming language . | https://web.archive.org/web/20200125004752/https://en.wikipedia.org/wiki/Onyx_(programming_language) |
| Omnis Studio | Omnis Studio is a rapid application development (RAD) tool that allows programmers and application developers to create enterprise, web, and mobile applications for Windows, Linux, and macOS personal computers and servers across all business sectors. The Omnis JavaScript Client allows developers to build all types of web applications and mobile applications by presenting a highly functional interface in the user's desktop web browser, or on tablet and mobile devices. The business logic and database access in such web and mobile applications is handled by the Omnis server. The Omnis server also can act as a hub between database servers, services based on Java and .Net and clients like Adobe Air & Flex transferring data in the form of XML or Web services. | https://en.wikipedia.org/wiki/Omnis_Studio |
| Office Open XML | Office Open XML (also informally known as OOXML or Microsoft Open XML (MOX)) is a zipped, XML-based file format developed by Microsoft for representing spreadsheets, charts, presentations and word processing documents. The format was initially standardized by Ecma (as ECMA-376), and by the ISO and IEC (as ISO/IEC 29500) in later versions. Starting with Microsoft Office 2007, the Office Open XML file formats have become the default target file format of Microsoft Office. Microsoft Office 2010 provides read support for ECMA-376, read/write support for ISO/IEC 29500 Transitional, and read support for ISO/IEC 29500 Strict. Microsoft Office 2013 and Microsoft Office 2016 additionally support both reading and writing of ISO/IEC 29500 Strict. | https://en.wikipedia.org/wiki/Office_Open_XML |
| Obliq | Obliq is an interpreted, object-oriented programming language designed to make distributed, and locally multi-threaded, computation simple and easy for the programmer, while providing program safety and implicit type system. The interpreter is written in Modula-3, and provides Obliq with full access to Modula-3's network objects capabilities. A type inference algorithm for record concatenation, subtyping and recursive types has been developed for Obliq, more important it has been proved to be NP-complete and its lowest complexity to be Ο(n3) or if under other modeling up to certain conditions down to Ο(n2) and its best known implementation runs in Ο(n5). Obliq's syntax is very similar to Modula-3, the biggest difference being that Obliq has no need of explicit typed variables (i.e., a variable can hold any data type allowed by the type checker and if does not accepts one, i.e., a given expression execution error will be thrown) although explicit type declarations are allowed and ignored by the interpreter. The basic data types in the language include booleans, integers, reals, characters, strings, and arrays. Obliq supports the usual set of sequential control structures (conditional, iteration, and exception handling forms), as well as special control forms for concurrency (mutexes and guarded statements). Besides that Obliq's objects are able to be cloned and safely copied remotely by any machine in a distributed network object and it can be done in a transparent way. Obliq's large standard library provides strong support for mathematical operations, I/O, persistence, thread control, graphics, and animation. Distributed computation is object-based: objects hold a state, which is local to a particular process. Scope of objects and other variables is purely lexical. Objects can call methods of other objects, even if those objects are on another machine on the network. Obliq objects are simply collections of named fields (similar to slots in Self and Smalltalk), and support inheritance by delegation (like Self). The common uses of Obliq involve programming over networks, 3D animation, and distributed computation over Ethernet LAN as. Obliq is included free with the DEC Modula-3 distribution, but other free versions exist elsewhere including pre-compiled binaries for several operating systems. | https://en.wikipedia.org/wiki/Obliq |
| Objective-J | Objective-J is a programming language developed as part of the Cappuccino web development framework. Its syntax is nearly identical to the Objective-C syntax and it shares with JavaScript the same relationship that Objective-C has with the C programming language: that of being a strict, but small, superset; adding traditional inheritance and Smalltalk/Objective-C style dynamic dispatch. Pure JavaScript, being a prototype-based language, already has a notion of object orientation and inheritance, but Objective-J adds the use of class-based programming to JavaScript. Programs written in Objective-J need to be preprocessed before being run by a web browser's JavaScript virtual machine. This step can occur in the web browser at runtime or by a compiler which translates Objective-J programs into pure JavaScript code. The Objective-J compiler is written in JavaScript; consequently, deploying Objective-J programs does not require a web browser plug-in. Objective-J can be compiled and run on Node.js. | https://en.wikipedia.org/wiki/Objective-J |
| Objective-C | Objective-C is a general-purpose, object-oriented programming language that adds Smalltalk-style messaging to the C programming language. It was the main programming language used by Apple for the OS X and iOS operating systems, and their respective application programming interfaces (APIs) Cocoa and Cocoa Touch prior to the introduction of Swift. The programming language Objective-C was originally developed in the early 1980s. It was selected as the main language used by NeXT for its NeXTSTEP operating system, from which OS X and iOS are derived. Portable Objective-C programs that do not use the Cocoa or Cocoa Touch libraries, or those using parts that may be ported or reimplemented for other systems, can also be compiled for any system supported by GNU Compiler Collection (GCC) or Clang. Objective-C source code 'implementation' program files usually have .m filename extensions, while Objective-C 'header/interface' files have .h extensions, the same as C header files. Objective-C++ files are denoted with a .mm file extension. | https://en.wikipedia.org/wiki/Objective-C |
| ObjectPAL | ObjectPAL is short for Object-Oriented Paradox Application Language, which is the programming language used by the Borland Paradox database application (now owned by Corel). Paradox, now in its 11th version, is a constituent of Corel's Word Perfect X3 office suite, for 32-bit Microsoft Windows. The language is tightly-bound to the application's forms, and provides a very rapid and robust development environment for creating database applications for Windows. ObjectPAL is not a full free-standing object-oriented language. It belongs to the family of languages inspired by Hypercard, with influences from PAL (wherever functionality could be kept the same), Smalltalk, and Garnet (a UI language created by Brad Myers). While its objects do encapsulate source code, there is no support for polymorphism, and only a very limited inheritance concept, which is wedded to objects on a form which can be controlled by code placed on a higher object in a form's object hierarchy. However, for what it is, ObjectPAL provides a wideranging and versatile language for creating Paradox applications. The syntax and structure of the language resembles Visual Basic, but knowing Visual Basic would only help someone new to ObjectPAL in the sense that any other programming skill would be transferable to ObjectPAL. ObjectPAL was the successor to PAL, which was the Paradox for DOS programming language. With the advent of Paradox for Windows 1.0 in 1993, which was then owned by Borland Corporation, ObjectPAL was born. Version 1.0 was quickly succeeded by version 4.5 that same year. It can be used as such as a web server scripting language when combined with the Corel Web Server Control OCX, which implements a server API similar to the CGI, and its standalone console, the Corel Web Server. | https://en.wikipedia.org/wiki/ObjectPAL |
| ObjectLOGO | ObjectLOGO is a variant of the programming language Logo with object-oriented programming extensions and lexical scoping. Version 2.7 is sold by Digitool, Inc. It is no longer being developed or supported, and does not run on versions of the Mac operating system after version 7.5. | https://en.wikipedia.org/wiki/ObjectLOGO |
| Object-Z | Object-Z is an object-oriented extension to the Z notation developed at the University of Queensland, Australia. Object-Z extends Z by the addition of language constructs resembling the object-oriented paradigm, most notably, classes. Other object-oriented notions such as polymorphism and inheritance are also supported. While not as popular as its base language Z, Object-Z has still received significant attention in the formal methods community, and research on aspects of the language are ongoing, including hybrid languages using Object-Z, tool support (e.g., through the Community Z Tools project) and refinement calculi. | https://en.wikipedia.org/wiki/Object-Z |
| OGNL | Object-Graph Navigation Language (OGNL) is an open-source Expression Language (EL) for Java, which, while using simpler expressions than the full range of those supported by the Java language, allows getting and setting properties (through defined setProperty and getProperty methods, found in JavaBeans), and execution of methods of Java classes. It also allows for simpler array manipulation. It is aimed to be used in Java EE applications with taglibs as expression language. OGNL was created by Luke Blanshard and Drew Davidson of OGNL Technology. OGNL development was continued by OpenSymphony, which closed in 2011. OGNL is developed now as a part of the Apache Commons. | https://en.wikipedia.org/wiki/OGNL |
| OQL | Object Query Language (OQL) is a query language standard for object-oriented databases modeled after SQL. OQL was developed by the Object Data Management Group (ODMG). Because of its overall complexity nobody has ever fully implemented the complete OQL. OQL has influenced the design of some of the newer query languages like JDOQL and EJB QL, but they can't be considered as different flavors of OQL. | https://en.wikipedia.org/wiki/Object_Query_Language |
| Object Pascal | Object Pascal refers to a branch of object-oriented derivatives of Pascal, mostly known as the primary programming language of Embarcadero Delphi. | https://en.wikipedia.org/wiki/Object_Pascal |
| Object Oberon | Object Oberon is a programming language which is based on the Oberon programming language with features for object-oriented programming. Oberon-2 was essentially a redesign of Object Oberon. | https://en.wikipedia.org/wiki/Object_Oberon |
| Object Linking and Embedding | Object Linking & Embedding (OLE) is a proprietary technology developed by Microsoft that allows embedding and linking to documents and other objects. For developers, it brought OLE Control Extension (OCX), a way to develop and use custom thing of users using interface elements. On a technical level, an OLE object is any object that implements the IOleObject interface, possibly along with a wide range of other interfaces, depending on the object's needs. | https://en.wikipedia.org/wiki/Object_Linking_and_Embedding |
| Object Definition Language | Object Definition Language (ODL) is the specification language defining the interface to object types conforming to the ODMG Object Model. Often abbreviated by the acronym ODL. This language's purpose is to define the structure of an Entity-relationship diagram. | https://web.archive.org/web/20190430204008/https://en.wikipedia.org/wiki/Object_Definition_Language |
| Oberon-2 | Oberon-2 is an extension of the original Oberon programming language that adds limited reflection and object-oriented programming facilities, open arrays as pointer base types, read-only field export and reintroduces the FOR loop from Modula-2. It was developed in 1991 at ETH Zurich by Niklaus Wirth and Hanspeter Mössenböck, who is now at Institut für Systemsoftware (SSW) of the University of Linz, Austria. Oberon-2 is a superset of Oberon, and is fully compatible with it. Oberon-2 was a redesign of Object Oberon. Oberon-2 inherited limited reflection and single inheritance ("type extension") without interfaces or mixins from Oberon, but added efficient virtual methods ("type bound procedures"). Method calls were resolved at run-time using C++-style virtual method tables. Compared to fully object-oriented programming languages like Smalltalk, in Oberon-2 basic types are not objects, classes are not objects, many operations are not methods, there is no message passing (to a certain extent it can be emulated by reflection and through message extension, as demonstrated in ETH Oberon), and polymorphism is limited to subclasses of a common class (no duck typing like in Python, and it's not possible to define interfaces like in Java). Oberon-2 does not support encapsulation at object/class level, but modules can be used for this purpose. Reflection in Oberon-2 does not use meta-objects, but simply reads from type descriptors compiled into the executable binaries, and exposed in the modules that define the types and/or procedures. If the format of these structures are exposed at the language level (as is the case for ETH Oberon, for example), reflection could be implemented at the library level. It could therefore be implemented almost entirely at library level, without changing the language code. Indeed, ETH Oberon makes use of language-level and library-level reflection capabilities extensively. Oberon-2 provides built-in run-time support for garbage collection similar to Java and performs bounds and array index checks, etc. that eliminate the potential stack and array bounds overwriting problems and manual memory management issues inherent in C/C++. Separate compilation using symbol files and name-spaces via the module architecture ensure quick rebuilds since only modules with changed interfaces need to be recompiled. The language Component Pascal is a refinement (a superset) of Oberon-2. | https://en.wikipedia.org/wiki/Oberon-2 |
| Oberon | Oberon is a general-purpose programming language created in 1986 by Niklaus Wirth and the latest member of the Wirthian family of ALGOL-like languages (Euler, Algol-W, Pascal, Modula, and Modula-2). Oberon was the result of a concentrated effort to increase the power of Modula-2, the direct successor of Pascal, and simultaneously to reduce its complexity. Its principal new feature is the concept of type extension of record types: It permits the construction of new data types on the basis of existing ones and to relate them, deviating from the dogma of strictly static data typing. Type extension is Wirth's way of inheritance reflecting the viewpoint of the parent site. Oberon was developed as part of the implementation of the Oberon operating system at ETH Zurich in Switzerland. The name is from the moon of Uranus, Oberon. Oberon is still maintained by Wirth and the latest revision is dated May 3, 2016. | https://en.wikipedia.org/wiki/Oberon_(programming_language) |
| Oak | Oak is a discontinued programming language created by James Gosling in 1991, initially for Sun Microsystems' set-top box project. The language later evolved to become Java. The name Oak was used by Gosling after an oak tree that stood outside his office. | https://en.wikipedia.org/wiki/Oak_(programming_language) |
| OWBasic | OWBasic is an interpreted language environment that can be downloaded to Personal digital assistants like the Casio's Pocket viewer. | https://en.wikipedia.org/wiki/OWBasic |
| OPS5 | OPS5 is a rule-based or production system computer language, notable as the first such language to be used in a successful expert system, the R1/XCON system used to configure VAX computers. The OPS (said to be short for "Official Production System") family was developed in the late 1970s by Charles Forgy while at Carnegie Mellon University. Allen Newell's research group in artificial intelligence had been working on production systems for some time, but Forgy's implementation, based on his Rete algorithm, was especially efficient, sufficiently so that it was possible to scale up to larger problems involving hundreds or thousands of rules. OPS5 uses a forward chaining inference engine; programs execute by scanning "working memory elements" (which are vaguely object-like, with classes and attributes) looking for matches with the rules in "production memory". Rules have actions that may modify or remove the matched element, create new ones, perform side effects such as output, and so forth. Execution continues until no more matches can be found. In this sense, OPS5 is an execution engine for a Petri net extended with inhibitor arcs. The OPS5 forward chaining process makes it extremely parallelizeable during the matching phase, and several automatic parallelizing compilers were created. OPS4 was an early version, while OPS83 came later. The first implementation of OPS5 was written in Lisp, and later rewritten in BLISS for speed. DEC OPS5 is an extended implementation of the OPS5 language definition, developed for use with the VMS, RISC ULTRIX, and DEC OSF/1 operating systems. | https://en.wikipedia.org/wiki/OPS5 |
| Opal | OPAL (OPtimized Applicative Language) is a functional programming language first developed at the Technical University of Berlin. | https://en.wikipedia.org/wiki/Opal_(programming_language) |
| OMeta | OMeta is a specialized object-oriented programming language for pattern matching, developed by Alessandro Warth and Ian Piumarta in 2007 under the Viewpoints Research Institute. The language is based on Parsing Expression Grammars (PEGs) rather than Context-Free Grammars with the intent of providing “a natural and convenient way for programmers to implement tokenizers, parsers, visitors, and tree-transformers”.OMeta's main goal is to allow a broader audience to use techniques generally available only to language programmers, such as parsing. It is also known for its use in quickly creating prototypes, though programs written in OMeta are noted to be generally less efficient than those written in vanilla (base language) implementations, such as JavaScript.OMeta is noted for its use in creating domain-specific languages, and especially for the maintainability of its implementations (Newcome). OMeta, like other meta languages, requires a host language; it was originally created as a COLA implementation. | https://en.wikipedia.org/wiki/OMeta |
| OCaml | OCaml ( oh-KAM-əl), originally named Objective Caml, is the main implementation of the programming language Caml, created by Xavier Leroy, Jérôme Vouillon, Damien Doligez, Didier Rémy, Ascánder Suárez and others in 1996. A member of the ML language family, OCaml extends the core Caml language with object-oriented programming constructs. OCaml's toolset includes an interactive top-level interpreter, a bytecode compiler, a reversible debugger, a package manager (OPAM), and an optimizing native code compiler. It has a large standard library, making it useful for many of the same applications as Python or Perl, and has robust modular and object-oriented programming constructs that make it applicable for large-scale software engineering. OCaml is the successor to Caml Light. The acronym CAML originally stood for Categorical Abstract Machine Language, although OCaml omits this abstract machine. OCaml is a free and open-source software project managed and principally maintained by French Institute for Research in Computer Science and Automation (INRIA). In the early 2000s, many new languages adopted elements from OCaml, most notably F# and Scala. | https://en.wikipedia.org/wiki/OCaml |
| OBJ | OBJ is a programming language family introduced by Joseph Goguen in 1976. It is a family of declarative "ultra high-level" languages. It features abstract types, generic modules, subsorts (subtypes with multiple inheritance), pattern-matching modulo equations, E-strategies (user control over laziness), module expressions (for combining modules), theories and views (for describing module interfaces) for the massively parallel RRM (rewrite rule machine). Members of the OBJ family of languages include CafeOBJ, Eqlog, FOOPS, Kumo, Maude and OBJ3. | https://en.wikipedia.org/wiki/OBJ_%28programming_language%29 |
| Wavefront Object | OBJ (or .OBJ) is a geometry definition file format first developed by Wavefront Technologies for its Advanced Visualizer animation package. The file format is open and has been adopted by other 3D graphics application vendors. The OBJ file format is a simple data-format that represents 3D geometry alone — namely, the position of each vertex, the UV position of each texture coordinate vertex, vertex normals, and the faces that make each polygon defined as a list of vertices, and texture vertices. Vertices are stored in a counter-clockwise order by default, making explicit declaration of face normals unnecessary. OBJ coordinates have no units, but OBJ files can contain scale information in a human readable comment line. | https://en.wikipedia.org/wiki/Wavefront_.obj_file |
| O-Matrix | O-Matrix is a matrix programming language for mathematics, engineering, science, and financial analysis, marketed by Harmonic Software. The language is designed for use in high-performance computing. O-Matrix provides an integrated development environment and a matrix-based scripting language. The environment includes mathematical, statistical, engineering and visualization functions. The set of analysis functions is designed for development of complex, computationally intensive scientific, mathematical and engineering applications. The integrated environment provides a mode that is largely compatible with version 4 of the MATLAB language in the commercial product from MathWorks. Certain features of MATLAB, such as non-numeric data types (structures, cell arrays and objects), error handling with try/catch, and nested and anonymous functions, are missing in O-Matrix. The O-Matrix environment includes a virtual machine of the O-Matrix language to enable re-distribution of applications. | https://en.wikipedia.org/wiki/O-Matrix |
| Nyquist | Nyquist is a programming language for sound synthesis and analysis based on the Lisp programming language. It is an extension of the XLISP dialect of Lisp, and is named after Harry Nyquist. | https://en.wikipedia.org/wiki/Nyquist_(programming_language) |
| Nuprl | Nuprl is a proof development system, providing computer-mediated analysis and proofs of formal mathematical statements, and tools for software verification and optimization. Originally developed in the 1980s by Robert Lee Constable and others, the system is now maintained by the PRL Project at Cornell University. The currently supported version, Nuprl 5, is also known as FDL (Formal Digital Library). Nuprl functions as an automated theorem proving system and can also be used to provide proof assistance. | https://en.wikipedia.org/wiki/Nuprl |
| Mudlle | Numerous computer and video games have been inspired by J. R. R. Tolkien's works set in Middle-earth. Titles have been produced by studios such as Electronic Arts, Sierra, Melbourne House, and Warner Bros. Interactive Entertainment, which currently owns the gaming rights. | https://en.wikipedia.org/wiki/Mudlle |
| Numbers | Numbers is a spreadsheet application developed by Apple Inc. as part of the iWork productivity suite alongside Keynote and Pages. Numbers is available for iOS, and macOS High Sierra or newer. Numbers 1.0 on OS X was announced on 7 August 2007, making it the newest application in the iWork suite. The iPad version was released on 27 January 2010. The app was later updated to support iPhone and iPod Touch. Numbers uses a free-form "canvas" approach that demotes tables to one of many different media types placed on a page. Other media, like charts, graphics and text, are treated as peers. In comparison, traditional spreadsheets like Microsoft Excel use the table as the primary container, with other media placed within the table. Numbers also includes features from the seminal Lotus Improv, notably the use of formulas based on ranges rather than cells. However, it implements these using traditional spreadsheet concepts, as opposed to Improv's use of multidimensional databases. Numbers also includes numerous stylistic improvements in an effort to improve the visual appearance of spreadsheets. At its introductory demonstration, Steve Jobs pitched a more usable interface and better control over the appearance and presentation of tables of data. | https://en.wikipedia.org/wiki/Numbers_(spreadsheet) |
| NumPy | NumPy (pronounced (NUM-py) or sometimes (NUM-pee)) is a library for the Python programming language, adding support for large, multi-dimensional arrays and matrices, along with a large collection of high-level mathematical functions to operate on these arrays. The ancestor of NumPy, Numeric, was originally created by Jim Hugunin with contributions from several other developers. In 2005, Travis Oliphant created NumPy by incorporating features of the competing Numarray into Numeric, with extensive modifications. NumPy is open-source software and has many contributors. | https://en.wikipedia.org/wiki/NumPy |
| NSIS | Nullsoft Scriptable Install System (NSIS) is a script-driven installer authoring tool for Microsoft Windows with minimal overhead backed by Nullsoft, the creators of Winamp. NSIS is released under a combination of free software licenses, primarily the zlib license. It has become a widely used alternative to commercial proprietary products like InstallShield, with users including Amazon.com, Dropbox, Ubisoft, FL Studio, BitTorrent, and McAfee. | https://en.wikipedia.org/wiki/Nullsoft_Scriptable_Install_System |
| Nu | Nu is an interpreted object-oriented programming language, with a Lisp-like syntax, created by Tim Burks as an alternative scripting language to program OS X through its Cocoa application programming interface (API). Implementations also exist for iPhone and Linux. The language was first announced at C4, a conference for indie Mac developers held in August 2007. | https://en.wikipedia.org/wiki/Nu_(programming_language) |
| Notepad++ | Notepad++ is a text editor and source code editor for use with Microsoft Windows. It supports tabbed editing, which allows working with multiple open files in a single window. The project's name comes from the C increment operator. Notepad++ is distributed as free software. At first the project was hosted on SourceForge.net, from where it has been downloaded over 28 million times, and twice won the SourceForge Community Choice Award for Best Developer Tool. The project was hosted on TuxFamily from 2010 to 2015; since 2015 Notepad++ has been hosted on GitHub. Notepad++ uses the Scintilla editor component. | https://en.wikipedia.org/wiki/Notepad++ |
| Microsoft Notepad | Notepad is a simple text editor for Microsoft Windows and a basic text-editing program which enables computer users to create documents. It was first released as a mouse-based MS-DOS program in 1983, and has been included in all versions of Microsoft Windows since Windows 1.0 in 1985. | https://en.wikipedia.org/wiki/Microsoft_Notepad |
| Notation3 | Notation3, or N3 as it is more commonly known, is a shorthand non-XML serialization of Resource Description Framework models, designed with human-readability in mind: N3 is much more compact and readable than XML RDF notation. The format is being developed by Tim Berners-Lee and others from the Semantic Web community. A formalization of the logic underlying N3 was published by Berners-Lee and others in 2008.N3 has several features that go beyond a serialization for RDF models, such as support for RDF-based rules. Turtle is a simplified, RDF-only subset of N3. | https://en.wikipedia.org/wiki/Notation3 |
| Not eXactly C | Not eXactly C, or NXC, is a high-level programming language for the Lego Mindstorms NXT designed by John Hansen in 2006. NXC, which is short for Not eXactly C, is based on Next Byte Codes, an assembly language. NXC has a syntax like C. The IDE for NXC is the Bricx Command Center. The NXC compiler is available under the Mozilla Public License. A sample code is as shown below: | https://en.wikipedia.org/wiki/Not_eXactly_C |
| Not Quite C | Not Quite C (NQC) is a programming language, application programming interface (API), and native bytecode compiler toolkit for the Lego Mindstorms, Cybermaster and LEGO Spybotics systems. It is based primarily on the C language but has specific limitations, such as the maximum number of subroutines and variables allowed, which differ depending on the version of firmware the RCX has. The language was invented by David Baum. He has released two books on the subject. | https://en.wikipedia.org/wiki/Not_Quite_C |
| NorthStar BASIC | NorthStar BASIC was a dialect of the programming language BASIC originally provided for use on the NorthStar Horizon and NorthStar Advantage. The interpreter was written using only Intel 8080 instructions so that it could run also on custom systems. One notable difference with other dialects of BASIC of the time was the array-like way in which strings were addressed. For example, A$(13,17) in NorthStar BASIC corresponded to MID$(A$,13,5) in other dialects. This string addressing technique is analogous to the one used in Fortran, and was also used in HP-3000 Basic and Atari BASIC. Strings were allocated 10 bytes maximum length unless DIMensioned otherwise. It was still possible to use arrays of strings, but these were declared in two or more dimensions, for example DIM B$(10,50) created 11 strings (0-10) of maximum length 50 bytes. Input from the keyboard and output to the console and printers were treated in the same way as reading and writing to data files. Some other differences were that POKE became FILL, PEEK became EXAM, and INSTR became MATCH.Some other dialects of BASIC were created which were based on and inspired by NorthStar BASIC, such as Bazic (a rewrite of North Star BASIC taking advantage of the faster Zilog Z80 instructions), Megabasic and S.A.I.L.B.O.A.T. (a basic optimized for Z80 and X86 MS-DOS). Some of these were available for other hardware and operating systems, including Unix, CP/M and DOS. | https://en.wikipedia.org/wiki/NorthStar_BASIC |
| Nord Programming Language | Nord Programming Language, commonly abbreviated NPL, was a programming language by the Norwegian minicomputer manufacturer Norsk Data. It shipped as a standard component of the operating system SINTRAN III. The language was also used to implement SINTRAN III. I.e. the core and file system of SINTRAN III was written in NPL. The NPL compiler was also written in NPL and some core applications was early on written in NPL until PLANC came and linker and other software was rewritten in PLANC. The NPL compiler was also special in that it did not produce object code as most compilers do. Instead it produced assembler code which then had to be assembled using the Norsk Data Assembler. The registers of the CPU were available in NPL as predefined variables. Thus you could write: X + T =: A and the compiler would generate: COPY SX DA RADD ST DA Functions could be declared with multiple entry points: FUNC FUN1, FUN2 FUN1: T := 1 FUN2: code here END FUN1 could be called to set T to 1 before falling into FUN2 or T could be set to something else and call FUN2. If T register specified which file handle to write to then either FUN1 could be called to always output to terminal or T could be specified to handle a file itself in T and call FUN2 to output to that file. | https://en.wikipedia.org/wiki/Nord_Programming_Language |
| Nomad software | Nomad Software is a relational database and fourth-generation language (4GL), originally developed in the 1970s by time-sharing vendor National CSS. While it is still in use today, its widest use was in the 1970s and 1980s. Nomad provides both interactive and batch environments for data management and application development, including commands for database definition, data manipulation, and reporting. All components are accessible by and integrated through a database-oriented programming language. Unlike many tools for managing mainframe data, which are geared to the needs of professional programmers in MIS departments, Nomad is particularly designed for (and sold to) application end-users in large corporations. End-users employ Nomad in batch production cycles and in Web-enabled applications, as well as for reporting and distribution via the Web or PC desktop. | https://en.wikipedia.org/wiki/Nomad_software |
| Node.js | Node.js is an open-source, cross-platform JavaScript run-time environment that executes JavaScript code outside of a browser. Typically, JavaScript is used primarily for client-side scripting, in which scripts written in JavaScript are embedded in a webpage's HTML and run client-side by a JavaScript engine in the user's web browser. Node.js lets developers use JavaScript to write Command Line tools and for server-side scripting—running scripts server-side to produce dynamic web page content before the page is sent to the user's web browser. Consequently, Node.js represents a "JavaScript everywhere" paradigm, unifying web application development around a single programming language, rather than different languages for server side and client side scripts. Though .js is the conventional filename extension for JavaScript code, the name "Node.js" does not refer to a particular file in this context and is merely the name of the product. Node.js has an event-driven architecture capable of asynchronous I/O. These design choices aim to optimize throughput and scalability in web applications with many input/output operations, as well as for real-time Web applications (e.g., real-time communication programs and browser games).The Node.js distributed development project, governed by the Node.js Foundation, is facilitated by the Linux Foundation's Collaborative Projects program.Corporate users of Node.js software include GoDaddy, Groupon, IBM, LinkedIn, Microsoft, Netflix, PayPal, Rakuten, SAP, Voxer, Walmart, and Yahoo!. | https://en.wikipedia.org/wiki/nodejs |
| NixOS | NixOS is a Linux distribution built on top of the Nix package manager. It uses declarative configuration and allows reliable system upgrades. Two main branches are offered: current Stable release and Unstable following latest development. Although NixOS started as a research project, it is a fully functional and usable operating system.NixOS has tools dedicated to DevOps and deployment tasks. | https://en.wikipedia.org/wiki/NixOS |
| Nios II | Nios II is a 32-bit embedded-processor architecture designed specifically for the Altera family of FPGAs. Nios II incorporates many enhancements over the original Nios architecture, making it more suitable for a wider range of embedded computing applications, from DSP to system-control. Nios II is comparable to MicroBlaze, a competing softcore CPU for the Xilinx family of FPGA. Unlike Microblaze, Nios II is licensable for standard-cell ASICs through a third-party IP provider, Synopsys Designware. Through the Designware license, designers can port Nios-based designs from an FPGA-platform to a mass production ASIC-device. Nios II is a successor to Altera's first configurable 16-bit embedded processor Nios. | https://en.wikipedia.org/wiki/Nios_II |
| Ninja | Ninja is a small build system with a focus on speed. It differs from other build systems in two major respects: it is designed to have its input files generated by a higher-level build system, and it is designed to run builds as fast as possible. In essence, Ninja is meant to replace Make, which is slow when performing incremental (or no-op) builds. This can considerably slow down developers working on large projects, such as Google Chrome which compiles 30,000 input files into a single executable. In fact, Google Chrome is a main user and motivation for Ninja. It's also used to build Android, and is used by most developers working on LLVM.In contrast to Make, Ninja lacks features such as string manipulation, as Ninja build files are not meant to be written by hand. Instead, a "build generator" should be used to generate Ninja build files. CMake and Meson are popular build management software tools which support creating build files for Ninja. | https://en.wikipedia.org/wiki/Ninja_(build_system) |
| Nim | Nim (formerly named Nimrod) is an imperative, multi-paradigm, compiled programming language designed and developed by Andreas Rumpf. It is designed to be "efficient, expressive, and elegant", supporting metaprogramming, functional, message passing, procedural, and object-oriented programming styles by providing several features such as compile time code generation, algebraic data types, a foreign function interface (FFI) with C and compiling to JavaScript, C and C++. | https://en.wikipedia.org/wiki/Nim_(programming_language) |
| Nickle | Nickle is a numeric oriented programming language by Keith Packard and Bart Massey. Originally used for desktop calculation, it has since expanded for prototyping of complicated algorithms. | https://en.wikipedia.org/wiki/Nickle_(programming_language) |
| Nice | Nice is an object-oriented programming language released under the GNU General Public License. It features a powerful type system which can help eliminate many common bugs, such as null pointer dereferences and invalid casts, by detecting potential runtime errors at compile-time; the goal of the designers was to provide safety features comparable to those found in languages such as ML and Haskell, but using a more conventional syntax. Nice aims to be feature-rich, and as such, in addition to the common features of modern object-oriented programming languages, it implements contracts in the style of Eiffel, class extensibility through multimethods, and many concepts drawn from functional programming such as anonymous functions, tuples, pattern matching (“value dispatch”), and parametric polymorphism. Source programs are compiled to Java bytecode, and can therefore interact with libraries written in Java and other programming languages targeting the Java Virtual Machine. Work on the Nice language appears to have slowed since early 2006. | https://en.wikipedia.org/wiki/Nice_(programming_language) |
| Nial | Nial (from "Nested Interactive Array Language") is a high-level array programming language developed from about 1981 by Mike Jenkins of Queen's University, Kingston, Ontario, Canada. Jenkins co-created the Jenkins–Traub algorithm. Nial combines a functional programming notation for arrays based on an array theory developed by Trenchard More with structured programming concepts for numeric, character and symbolic data. It is most often used for prototyping and artificial intelligence. | https://en.wikipedia.org/wiki/Nial |
| Nginx | Nginx ( EN-jin-EKS) (stylized as NGINX, NGiИX or nginx) is a web server which can also be used as a reverse proxy, load balancer, mail proxy and HTTP cache. The software was created by Igor Sysoev and first publicly released in 2004. A company of the same name was founded in 2011 to provide support and Nginx plus paid software.Nginx is free and open-source software, released under the terms of a BSD-like license. A large fraction of web servers use NGINX, often as a load balancer. | https://en.wikipedia.org/wiki/Nginx |
| NewtonScript | NewtonScript is a prototype-based programming language created to write programs for the Newton platform. It is heavily influenced by the Self programming language, but modified to be more suited to needs of mobile and embedded devices. | https://en.wikipedia.org/wiki/NewtonScript |
| Newsqueak | Newsqueak is a concurrent programming language for writing application software with interactive graphical user interfaces. Newsqueak's syntax and semantics are influenced by the C language, but its approach to concurrency was inspired by C. A. R. Hoare's communicating sequential processes (CSP). However, in Newsqueak, channels are first-class objects, with dynamic process creation and dynamic channel creation. Newsqueak was developed from an earlier, smaller, language, called Squeak (not to be confused with the Smalltalk implementation Squeak). It was developed by Luca Cardelli and Rob Pike at Bell Labs in the first half of the 1980s as a language for implementing graphical user interfaces. Both languages were presented as "a language for communicating with mice": their main aim was to model the concurrent nature of programs interacting with multiple input devices, viz., keyboards and mice.The ideas present in Newsqueak were further developed in the programming languages Alef, Limbo, and Go. | https://en.wikipedia.org/wiki/Newsqueak |
| Newspeak | Newspeak is a programming language and platform in the tradition of Smalltalk and Self being developed by a team led by Gilad Bracha. The platform includes an IDE, a GUI library, and standard libraries. Starting in 2006, Cadence Design Systems funded its development and employed the main contributors, but ceased funding in January 2009. Newspeak is a class based language. Classes may be nested, as in BETA. This is one of the key differences between Newspeak and Smalltalk. All names in Newspeak are late-bound, and are interpreted as message sends, as in Self. Newspeak is distinguished by its unusual approach to modularity. The language has no global namespace. Top level classes act as module declarations. Module declarations are first class values (i.e., they may be stored in variables, passed as parameters, returned from methods, etc.) and are stateless. | https://en.wikipedia.org/wiki/Newspeak_(programming_language) |
| NetRexx | NetRexx is an open source, originally IBM's, variant of the REXX programming language to run on the Java virtual machine. It supports a classic REXX syntax, with no reserved keywords, along with considerable additions to support object-oriented programming in a manner compatible with Java's object model, yet can be used as both a compiled and an interpreted language, with an option of using only data types native to the JVM or the NetRexx runtime package. The latter offers the standard Rexx data type that combines string processing with unlimited precision decimal arithmetic. Integration with the JVM platform is tight, and all existing Java class libraries can be used unchanged and without special setup; at the same time, a Java programmer can opt to just use the Rexx class from the runtime package for improved string handling in Java syntax source programs.NetRexx is free to download from the Rexx Language Association. IBM announced the transfer of NetRexx 3.00 source code to the Rexx Language Association (RexxLA) on June 8, 2011. | https://en.wikipedia.org/wiki/NetRexx |
| NetLogo | NetLogo is an agent-based programming language and integrated modeling environment. | https://en.wikipedia.org/wiki/NetLogo |
| NetLinx | NetLinx is both a range of controllers manufactured by AMX and the name of the proprietary programming language (loosely based on C) used to program the devices. The NetLinx controllers are rack mountable devices which run a version of VxWorks and integrate both a processor and device controllers and are typically utilized for audio-visual control systems. An example is the mid-range NetLinx Integrated NI-2100 controller which has 3 RS-232/RS-485 serial ports, 4 relays, 4 infrared/serial ports and 4 input/outputs. Serial ports can send and receive strings, typically ASCII instructions and replies. Relays permit switching of modest currents. IR ports can send infrared signals which emulate typical remote control devices that control (for instance) televisions and video recorders. Input/output ports detect contact closures. AMX supplies an IDE known as NetLinx Studio which allows a proprietary language to be edited, compiled and sent to the NetLinx controller. NetLinx also contains an interface which allows it to utilize Java based modules. Earlier models of AMX controller were named Axcent. | https://en.wikipedia.org/wiki/NetLinx |
| Nemerle | Nemerle is a general-purpose high-level statically typed programming language designed for platforms using the Common Language Infrastructure (.NET/Mono). It offers functional, object-oriented (OO) and imperative features. It has a simple C#-like syntax and a powerful metaprogramming system. In June 2012, the core developers of Nemerle were hired by the Czech software development company JetBrains. The team is focusing on developing Nitra, a framework to implement extant and new programming languages. This framework will likely be used to create future versions of Nemerle. Nemerle is named after the Archmage Nemmerle, a character in the fantasy novel A Wizard of Earthsea by Ursula K. Le Guin. | https://en.wikipedia.org/wiki/Nemerle |
| Neko | Neko is a high-level dynamically typed programming language developed by Nicolas Cannasse as part of research and development (R&D) efforts at two indie video game firms in Bordeaux, France: first at Motion Twin and then at Shiro Games. | https://en.wikipedia.org/wiki/Neko_(programming_language) |
| NeXML format | NeXML is an exchange standard for representing phyloinformatic data. It was inspired by the widely used Nexus file format but uses XML to produce a more robust format for rich phylogenetic data. Advantages include syntax validation, semantic annotation, and web services. The format is broadly supported and has libraries in many popular programming languages for bioinformatics. | https://en.wikipedia.org/wiki/NeXML_format |
| Napier88 | Napier88 is an orthogonally persistent programming language that was designed and implemented at the University of St Andrews, Scotland. The primary designer was Ron Morrison, whose initial designs were extended and implemented by Fred Brown, Richard Connor, and Al Dearle. Napier88 was ahead of its time in many ways, and was the first robustly implemented language to combine a polymorphic type system with orthogonal persistence. The language was robustly implemented and released to users from both industry and academia; up to 1,000 registered users were recorded in due course. The language, however, was only intended to provide a proof of concept for an experiment in persistent programming; some time after 1989 (the year the first implementation was in fact released) the group's interests moved on and the language was no longer maintained. Its influence lives on in various other systems however; the CORBA type ANY is distinctly recognisable in Napier88's type ANY; Microsoft's CLR uses a similar polymorphic architecture, and Java's parametric types solve some of the same problems of uninstantiated types escaping from their static scope. | https://en.wikipedia.org/wiki/Napier88 |
| Namespace-based Validation Dispatching Language | Namespace-based Validation Dispatching Language (NVDL) is an XML schema language for validating XML documents that integrate with multiple namespaces. It is an ISO/IEC standard, and it is Part 4 of the DSDL schema specification. Much of the work on NVDL is based on the older Namespace Routing Language. | https://en.wikipedia.org/wiki/Namespace-based_Validation_Dispatching_Language |
| NWScript | NWScript is the scripting language developed by BioWare for the role-playing video game Neverwinter Nights. It is based on the C programming language and is implemented in the Aurora toolset. Neverscript, an open source 3rd party editor, has been created for the Mac OS X and Linux versions of NWN because the Aurora toolset has not been ported to those platforms. NWScript is also used in the video games The Witcher, Star Wars: Knights of the Old Republic and Star Wars: Knights of the Old Republic II The Sith Lords, which use the Odyssey Engine. Neverwinter Nights 2, the sequel to the original NWN, features a modified version of this scripting language. | https://en.wikipedia.org/wiki/NWScript |
| New Technology File System | NTFS (New Technology File System) is a proprietary file system developed by Microsoft. Starting with Windows NT 3.1, it is the default file system of the Windows NT family.NTFS has several technical improvements over the file systems that it superseded – File Allocation Table (FAT) and High Performance File System (HPFS) – such as improved support for metadata and advanced data structures to improve performance, reliability, and disk space use. Additional extensions are a more elaborate security system based on access control lists (ACLs) and file system journaling. NTFS is supported in other desktop and server operating systems as well. Linux and BSD have a free and open-source NTFS driver, called NTFS-3G, with both read and write functionality. macOS comes with read-only support for NTFS; its disabled-by-default write support for NTFS is unstable. | https://en.wikipedia.org/wiki/NTFS |
| NS Basic | NS Basic is a family of development tools for the mobile devices developed and commercially marketed by NS BASIC Corporation in Toronto, Ontario, Canada for iOS, Android, BlackBerry OS, WebOS, Newton OS, Palm OS, Windows CE, Windows Mobile and Microsoft Windows. | https://en.wikipedia.org/wiki/NS_Basic |
| NPL | NPL is a functional programming language with pattern matching designed by Rod Burstall and John Darlington in 1977. The language allows certain sets and logic constructs to appear on the right hand side of definitions, e.g. setofeven(X) <= <:x: x in X & even(x) :>The NPL interpreter evaluates the list of generators from left to right so conditions can mention any bound variables that occur to their left. These were known as set comprehensions. NPL eventually evolved into Hope but lost set comprehensions, which made a reappearance in the form of list comprehensions in later functional languages. | https://en.wikipedia.org/wiki/NPL_(programming_language) |
| NEWP | NEWP (or the New Executive Programming Language) is a high-level programming language used on the Unisys MCP systems. The language is used to write the operating system and other system utilities, although it can also be used to write user software as well. Several constructs separate it from extended ALGOL on which it is based. Language operators such as MEMORY which allows direct memory access are strictly used by programs running as the MCP. | https://en.wikipedia.org/wiki/NEWP |
| NESL | NESL is a parallel programming language developed at Carnegie Mellon by the SCandAL project and released in 1993. It integrates various ideas from parallel algorithms, and functional programming and array programming languages. The most important new ideas behind NESL are Nested data parallelism: this feature offers the benefits of data parallelism, concise code that is easy to understand and debug, while being well suited for irregular algorithms, such as algorithms on trees, graphs or sparse matrices. A language based performance model: this gives a formal way to calculate the work and depth of a program. These measures can be related to running time on parallel machines.The main design guideline for NESL was to make parallel programming easy and portable. Algorithms are typically significantly more concise in NESL than in most other parallel programming languages, and the code closely resembles high-level pseudocode. NESL supports nested data parallelism by using the flattening transform to convert nested data parallelism to flat data parallelism. This works by storing nested vectors as the nested data and a segment descriptor of vector lengths, separately. This flattening transform, however, can increase the asymptotic work and space complexity of the original program, leading to a much less efficient result. | https://en.wikipedia.org/wiki/NESL |
| N-Triples | N-Triples is a format for storing and transmitting data. It is a line-based, plain text serialisation format for RDF (Resource Description Framework) graphs, and a subset of the Turtle (Terse RDF Triple Language) format. N-Triples should not be confused with Notation3 which is a superset of Turtle. N-Triples was primarily developed by Dave Beckett at the University of Bristol and Art Barstow at the World Wide Web Consortium (W3C).N-Triples was designed to be a simpler format than Notation3 and Turtle, and therefore easier for software to parse and generate. However, because it lacks some of the shortcuts provided by other RDF serialisations (such as CURIEs and nested resources, which are provided by both RDF/XML and Turtle) it can be onerous to type out large amounts of data by hand, and difficult to read. | https://en.wikipedia.org/wiki/N-Triples |
| MySQL | MySQL (officially pronounced as "My S-Q-L",) is an open-source relational database management system (RDBMS). Its name is a combination of "My", the name of co-founder Michael Widenius's daughter, and "SQL", the abbreviation for Structured Query Language. The MySQL development project has made its source code available under the terms of the GNU General Public License, as well as under a variety of proprietary agreements. MySQL was owned and sponsored by a single for-profit firm, the Swedish company MySQL AB, now owned by Oracle Corporation. For proprietary use, several paid editions are available, and offer additional functionality. MySQL is a central component of the LAMP open-source web application software stack (and other "AMP" stacks). LAMP is an acronym for "Linux, Apache, MySQL, Perl/PHP/Python". Applications that use the MySQL database include: TYPO3, MODx, Joomla, WordPress, phpBB, MyBB, and Drupal. MySQL is also used in many high-profile, large-scale websites, including Google (though not for searches), Facebook, Twitter, Flickr, and YouTube. | https://en.wikipedia.org/wiki/MySQL |
| MyBB | MyBB, formerly MyBBoard and originally MyBulletinBoard, is a free and open-source forum software developed by the MyBB Group. It is written in PHP, supports MySQL, PostgreSQL and SQLite as database systems and, in addition, has database failover support. It is available in multiple languages and is licensed under the LGPL. | https://en.wikipedia.org/wiki/MyBB |
| MusicXML | MusicXML is an XML-based file format for representing Western musical notation. The format is open, fully documented, and can be freely used under the W3C Community Final Specification Agreement. | https://en.wikipedia.org/wiki/MusicXML |
| MurmurHash | MurmurHash is a non-cryptographic hash function suitable for general hash-based lookup. It was created by Austin Appleby in 2008 and is currently hosted on GitHub along with its test suite named 'SMHasher'. It also exists in a number of variants, all of which have been released into the public domain. The name comes from two basic operations, multiply (MU) and rotate (R), used in its inner loop. Unlike cryptographic hash functions, it is not specifically designed to be difficult to reverse by an adversary, making it unsuitable for cryptographic purposes. | https://en.wikipedia.org/wiki/MurmurHash |
| MIME | Multipurpose Internet Mail Extensions (MIME) is an Internet standard that extends the format of email to support: Text in character sets other than ASCII Non-text attachments: audio, video, images, application programs etc. Message bodies with multiple parts Header information in non-ASCII character setsVirtually all human-written Internet email and a fairly large proportion of automated email is transmitted via SMTP in MIME format.MIME is specified in six linked RFC memoranda: RFC 2045, RFC 2046, RFC 2047, RFC 4288, RFC 4289 and RFC 2049; with the integration with SMTP email specified in detail in RFC 1521 and RFC 1522. Although MIME was designed mainly for SMTP, the content types defined by MIME standards are also of importance in communication protocols outside of email, such as HTTP for the World Wide Web. Servers insert the MIME header at the beginning of any Web transmission. Clients use this content type or media type header to select an appropriate viewer application for the type of data the header indicates. Some of these viewers are built into the Web client or browser (for example, almost all browsers come with GIF and JPEG image viewers as well as the ability to handle HTML files). | https://en.wikipedia.org/wiki/MIME |
| MultiDimensional eXpressions | Multidimensional Expressions (MDX) is a query language for online analytical processing (OLAP) using a database management system. Much like SQL, it is a query language for OLAP cubes. It is also a calculation language, with syntax similar to spreadsheet formulas. | https://en.wikipedia.org/wiki/MultiDimensional_eXpressions |
| Multics | Multics (Multiplexed Information and Computing Service) is an influential early time-sharing operating system, based around the concept of a single-level memory. Virtually all modern operating systems were heavily influenced by Multics – often through Unix, which was created by some of the people who had worked on Multics – either directly (Linux, macOS) or indirectly (Windows NT). | https://en.wikipedia.org/wiki/Multics |
| Multi-user BASIC | Multi-user BASIC was a dialect of the BASIC language for the DEC PDP-11 running the RT-11 operating system. One or more users were supported in separate address spaces sharing the same language interpreter. The syntax of the language was similar to but not identical to BASIC-11. A key language element was the support for virtual files. These were similar to the virtual arrays in BASIC-PLUS in but more limited. An array of integers, floatingpoint, or character strings of length 1, 2, 4, 8, 16, 32, or 64 could be placed in file and accessed with a subscript. The file could actually be opened (or re-opened) with a different definition allowing integers, characters, and floating point numbers to be stored in the same file. Like BASIC-11, Multi-User BASIC provided some support for lab equipment, support for character terminals (LA30, VT100). Because it was a multi-user system, it did not support real-time data collection. | https://en.wikipedia.org/wiki/Multi-user_BASIC |
| MUDDL | Multi-User Dungeon, or MUD (referred to as MUD1, to distinguish it from its successor, MUD2, and the MUD genre in general) is an early MUD and one of the oldest examples of a virtual world in existence. | https://en.wikipedia.org/wiki/MUDDL |
| muPad | MuPAD is a computer algebra system (CAS). Originally developed by the MuPAD research group at the University of Paderborn, Germany, development was taken over by the company SciFace Software GmbH & Co. KG in cooperation with the MuPAD research group and partners from some other universities starting in 1997. Until autumn 2005, the version "MuPAD Light" was offered for free for research and education, but as a result of the closure of the home institute of the MuPAD research group, only the version "MuPAD Pro" became available for purchase. The MuPAD kernel is bundled with Scientific Notebook and Scientific Workplace. Former versions of MuPAD Pro were bundled with SciLab. In MathCAD's version 14 release Mupad was adopted as the CAS engine. In September 2008, SciFace was purchased by MathWorks and the MuPAD code was included in the Symbolic Math Toolbox add-on for MATLAB. On 28 September 2008, MuPAD was withdrawn from the market as a software product in its own right. However, it is still available in the Symbolic Math Toolbox in MATLAB and can also be used as a stand-alone program. | https://en.wikipedia.org/wiki/MuPAD |
| Mortran | Mortran (More Fortran) is an extension of the Fortran programming language used for scientific computation. It introduces syntax changes, including the use of semicolons to end statements, in order to improve readability and flexibility. Mortran code is macro-processed into Fortran code for compilation. Note that Mortran, like many preprocessors, does not make a complete analysis of the Fortran source and, like many preprocessors, may not always make its assumptions/requirements explicit. Consider, for example, Mortran multiple assignment. From the Mortran User Guide: produces the following FORTRAN statements: In this example, the produced Fortran implements the multiple assignment correctly only if X is not aliased to I or to A(I,K), assuming the multiple assignment semantics are left to right. | https://en.wikipedia.org/wiki/Mortran |
| Morse code | Morse code is a character encoding scheme used in telecommunication that encodes text characters as standardized sequences of two different signal durations called dots and dashes or dits and dahs. Morse code is named for Samuel F. B. Morse, an inventor of the telegraph. The International Morse Code encodes the ISO basic Latin alphabet, some extra Latin letters, the Arabic numerals and a small set of punctuation and procedural signals (prosigns). Each Morse code symbol is formed by a sequence of dots and dashes. The dot duration is the basic unit of time measurement in Morse code transmission. The duration of a dash is three times the duration of a dot. Each dot or dash within a character is followed by period of signal absence, called a space, equal to the dot duration. The letters of a word are separated by a space of duration equal to three dots, and the words are separated by a space equal to seven dots. To increase the efficiency of encoding, Morse code was designed so that the length of each symbol is approximately inverse to the frequency of occurrence in text of the English language character that it represents. Thus the most common letter in English, the letter "E", has the shortest code: a single dot. Because the Morse code elements are specified by proportion rather than specific time durations, the code is usually transmitted at the highest rate that the receiver is capable of decoding. The Morse code transmission rate (speed) is specified in groups per minute, commonly referred to as words per minute.Morse code is usually transmitted by on-off keying of an information carrying medium such as electric current, radio waves, visible light or sound waves. The current or wave is present during time period of the dot or dash and absent during the time between dots and dashes.Morse code can be memorized, and Morse code signalling in a form perceptible to the human senses, such as sound waves or visible light, can be directly interpreted by persons trained in the skill.Because many non-English natural languages use other than the 26 Roman letters, Morse alphabets have been developed for those languages. In an emergency, Morse code can be generated by improvised methods such as turning a light on and off, tapping on an object or sounding a horn or whistle, making it one of the simplest and most versatile methods of telecommunication. The most common distress signal is SOS – three dots, three dashes, and three dots – internationally recognized by treaty. | https://en.wikipedia.org/wiki/Morse_code |
| Morfik | Morfik Technology Pty Ltd. is an Australian software company that was acquired by Altium in 2010. The company is known for developing a set of visual designers, compilers and a Framework combined in an Integrated development environment (IDE) aimed at developing Ajax applications in a high-level language such as Java, C#, BASIC or Object Pascal. Morfik includes visual design tools for Web interfaces, database structure, and queries. It supports the classic client–server model, however like all Ajax applications, the client-side code runs within a browser. The Morfik development tool converts the forms that the user draws into DHTML, compiles the client-logic into JavaScript, and builds the application and database server engines to house the server-side code. | https://en.wikipedia.org/wiki/Morfik |
| Monkey | Monkey X is a high-level programming language designed for video game development for many different platforms, including desktop and laptop computers, mobile phones, tablets, and video game consoles. The language itself is an object-oriented dialect of BASIC, which the compiler translates into native source code for several target platforms. The resulting code is then compiled normally. Currently the official target platforms include: Windows (Including the Windows 8 store), OS X, Linux, Xbox 360, Android, iOS, among others. Community-driven, user-made targets have also been created, some notable user-targets include: MonkeyMax (BlitzMax), Monkey-Python (Python), and a Nintendo DS target.Monkey X's main implementation (compiler), and a number of official modules are open source. Monkey X's main application/game framework, Mojo, is partially commercial. The compiler and most of the official modules can be found on GitHub. Monkey is also distributed in several compiled binary forms from its official website (registration required, to build the compiler). For details, see: Mojo (framework), and Game targets (technical). | https://en.wikipedia.org/wiki/Monkey_(programming_language) |
| MongoDB | MongoDB (from humongous) is a free and open-source cross-platform document-oriented database program. Classified as a NoSQL database program, MongoDB uses JSON-like documents with schemas. MongoDB is developed by MongoDB Inc., and is published under a combination of the GNU Affero General Public License and the Apache License. | https://en.wikipedia.org/wiki/MongoDB |
| Modula-3 | Modula-3 is a programming language conceived as a successor to an upgraded version of Modula-2 known as Modula-2+. While it has been influential in research circles (influencing the designs of languages such as Java, C#, and Python) it has not been adopted widely in industry. It was designed by Luca Cardelli, James Donahue, Lucille Glassman, Mick Jordan (before at the Olivetti Software Technology Laboratory), Bill Kalsow and Greg Nelson at the Digital Equipment Corporation (DEC) Systems Research Center (SRC) and the Olivetti Research Center (ORC) in the late 1980s. Modula-3's main features are simplicity and safety while preserving the power of a systems-programming language. Modula-3 aimed to continue the Pascal tradition of type safety, while introducing new constructs for practical real-world programming. In particular Modula-3 added support for generic programming (similar to templates), multithreading, exception handling, garbage collection, object-oriented programming, partial revelation and explicit mark of unsafe code. The design goal of Modula-3 was a language that implements the most important features of modern imperative languages in quite basic forms. Thus allegedly dangerous and complicating features such as multiple inheritance and operator overloading were omitted. | https://en.wikipedia.org/wiki/Modula-3 |
| Modula-2 | Modula-2 is a computer programming language designed and developed between 1977 and 1985 by Niklaus Wirth at the Swiss Federal Institute of Technology in Zurich (ETH Zurich) as a revision of Pascal to serve as the sole programming language for the operating system and application software for the personal workstation Lilith. The principal concepts were: The module as a compilation unit for separate compilation The coroutine as the basic building block for concurrent processes Types and procedures that allow access to machine-specific data. Modula-2 was viewed by Niklaus Wirth as a successor to his earlier programming languages Pascal and Modula. The language design was also influenced by the Mesa language and the new programming possibilities of the early personal computer Xerox Alto, both from Xerox, that Wirth saw during his 1976 sabbatical year at Xerox PARC. The computer magazine BYTE devoted the August 1984 issue to the language and its surrounding environment. | https://en.wikipedia.org/wiki/Modula-2 |
| Modelica | Modelica is an object-oriented, declarative, multi-domain modeling language for component-oriented modeling of complex systems, e.g., systems containing mechanical, electrical, electronic, hydraulic, thermal, control, electric power or process-oriented subcomponents. The free Modelica language is developed by the non-profit Modelica Association. The Modelica Association also develops the free Modelica Standard Library that contains about 1360 generic model components and 1280 functions in various domains, as of version 3.2.1. | https://en.wikipedia.org/wiki/Modelica |
| Model 204 | Model 204 (M204) is a database management system for IBM and compatible mainframe computers, “born” 1965 October 13, and first deployed in 1972. It incorporates a programming language and an environment for application development. Implemented in assembly language for IBM System/360 and its successors, M204 can deal with very large databases and transaction loads of 1000 TPS. | https://en.wikipedia.org/wiki/Model_204 |
| Miva | Miva Script is a proprietary computer scripting language mainly used for internet applications such as e-commerce. As of 2015, it is developed, maintained and owned by Miva Merchant, Inc., based in San Diego, California. Many web hosting companies support Miva Script on their servers, but it is significantly less widespread than other popular web languages. | https://en.wikipedia.org/wiki/MIVA_Script |
| Miranda | Miranda is a lazy, purely functional programming language designed by David Turner as a successor to his earlier programming languages SASL and KRC, using some concepts from ML and Hope. It was produced by Research Software Ltd. of England (which holds a trademark on the name Miranda) and was the first purely functional language to be commercially supported.Miranda was first released in 1985, as a fast interpreter in C for Unix-flavour operating systems, with subsequent releases in 1987 and 1989. Miranda had a strong influence on the later Haskell programming language. | https://en.wikipedia.org/wiki/Miranda_(programming_language) |
| Mirah | Mirah (formerly Duby) is a programming language based on Ruby language syntax, local type inference, hybrid static–dynamic type system, and a pluggable compiler toolchain. Mirah was created by Charles Oliver Nutter to be "a 'Ruby-like' language, probably a subset of Ruby syntax, that [could] compile to solid, fast, idiomatic JVM bytecode." The word mirah refers to the gemstone ruby in the Javanese language, a play on the concept of Ruby in Java. | https://en.wikipedia.org/wiki/Mirah_(programming_language) |
| Visual Studio | Microsoft Visual Studio is an integrated development environment (IDE) from Microsoft. It is used to develop computer programs, as well as websites, web apps, web services and mobile apps. Visual Studio uses Microsoft software development platforms such as Windows API, Windows Forms, Windows Presentation Foundation, Windows Store and Microsoft Silverlight. It can produce both native code and managed code. Visual Studio includes a code editor supporting IntelliSense (the code completion component) as well as code refactoring. The integrated debugger works both as a source-level debugger and a machine-level debugger. Other built-in tools include a code profiler, forms designer for building GUI applications, web designer, class designer, and database schema designer. It accepts plug-ins that enhance the functionality at almost every level—including adding support for source control systems (like Subversion and Git) and adding new toolsets like editors and visual designers for domain-specific languages or toolsets for other aspects of the software development lifecycle (like the Team Foundation Server client: Team Explorer). Visual Studio supports 36 different programming languages and allows the code editor and debugger to support (to varying degrees) nearly any programming language, provided a language-specific service exists. Built-in languages include C, C++, C++/CLI, Visual Basic .NET, C#, F#, JavaScript, TypeScript, XML, XSLT, HTML, and CSS. Support for other languages such as Python, Ruby, Node.js, and M among others is available via plug-ins. Java (and J#) were supported in the past. The most basic edition of Visual Studio, the Community edition, is available free of charge. The currently supported Visual Studio version is 2017. Microsoft announced 2019 on June 6, 2018, with its release timing to be shared "in the coming months," promising "to deliver ... quickly and iteratively." | https://en.wikipedia.org/wiki/Microsoft_Visual_Studio |
| Microsoft Small Basic | Microsoft Small Basic is a programming language and associated IDE. It is Microsoft's simplified variant of the BASIC programming language, intended as an easy programming language for beginners. The associated IDE provides a simplified programming environment with functionality such as syntax highlighting, intelligent code completion, and in-editor documentation access. The language has only 14 keywords. | https://en.wikipedia.org/wiki/Microsoft_Small_Basic |
| QuickBASIC | Microsoft QuickBASIC (also QB) is an Integrated Development Environment (or IDE) and compiler for the BASIC programming language that was developed by Microsoft. QuickBASIC runs mainly on DOS, though there was a short-lived version for the classic Mac OS. It is loosely based on GW-BASIC but adds user-defined types, improved programming structures, better graphics and disk support and a compiler in addition to the interpreter. Microsoft marketed QuickBASIC as the introductory level for their BASIC Professional Development System. Microsoft marketed two other similar IDEs for C and Pascal, viz QuickC and QuickPascal. | https://en.wikipedia.org/wiki/QuickBASIC |
| Microsoft Excel | Microsoft Excel is a spreadsheet developed by Microsoft for Windows, macOS, Android and iOS. It features calculation, graphing tools, pivot tables, and a macro programming language called Visual Basic for Applications. It has been a very widely applied spreadsheet for these platforms, especially since version 5 in 1993, and it has replaced Lotus 1-2-3 as the industry standard for spreadsheets. Excel forms part of Microsoft Office. | https://en.wikipedia.org/wiki/Microsoft_Excel |
| Microsoft BASIC | Microsoft BASIC is the foundation product of the Microsoft company. It first appeared in 1975 as Altair BASIC, which was the first BASIC by Microsoft and the first high level programming language available for the Altair 8800 microcomputer. During the home computer craze during the late-1970s and early-1980s, Microsoft BASIC was ported to and supplied with practically every computer design. Slight variations to add support for machine-specific functions led to a profusion of related designs like Commodore BASIC and Atari Microsoft BASIC. As the early home computers gave way to newer designs like the IBM PC and Apple Macintosh, BASIC was no longer as widely used, although it retained a strong following. The release of Visual BASIC reignited its popularity and it remains in wide use on Microsoft Windows platforms in its most recent incarnation, Visual Basic .NET | https://en.wikipedia.org/wiki/Microsoft_BASIC |
| Microsoft Azure | Microsoft Azure (formerly Windows Azure) is a cloud computing service created by Microsoft for building, testing, deploying, and managing applications and services through a global network of Microsoft-managed data centers. It provides software as a service (SaaS), platform as a service and infrastructure as a service and supports many different programming languages, tools and frameworks, including both Microsoft-specific and third-party software and systems. Azure was announced in October 2008 and released on February 1, 2010 as "Windows Azure" before being renamed "Microsoft Azure" on March 25, 2014. | https://en.wikipedia.org/wiki/Microsoft_Azure |
| Microdata HTML | Microdata is a WHATWG HTML specification used to nest metadata within existing content on web pages. Search engines, web crawlers, and browsers can extract and process Microdata from a web page and use it to provide a richer browsing experience for users. Search engines benefit greatly from direct access to this structured data because it allows them to understand the information on web pages and provide more relevant results to users. Microdata uses a supporting vocabulary to describe an item and name-value pairs to assign values to its properties. Microdata is an attempt to provide a simpler way of annotating HTML elements with machine-readable tags than the similar approaches of using RDFa and microformats. In 2013, because the W3C HTML Working Group failed to find someone to serve as an editor for the Microdata HTML specification, its development was terminated with a 'Note'. However, since that time, two new editors were selected, and five newer versions of the working draft have been published, the most recent being W3C Working Draft 26 April 2018. | https://en.wikipedia.org/wiki/Microdata_(HTML) |
| MicroPython | MicroPython is a software implementation of the Python 3 programming language, written in C, that is optimized to run on a microcontroller. MicroPython is a full Python compiler and runtime that runs on the micro-controller hardware. The user is presented with an interactive prompt (the REPL) to execute supported commands immediately. Included are a selection of core Python libraries; MicroPython includes modules which give the programmer access to low-level hardware.MicroPython was originally created by the Australian programmer and physicist Damien George, after a successful Kickstarter backed campaign in 2013. While the original Kickstart campaign released MicroPython with a pyboard microcontroller, MicroPython supports a number of ARM based architectures. MicroPython has since been run on Arduino platform based products, ESP8266, ESP32, and Internet of things hardware. In 2016 a version of MicroPython for the BBC Micro Bit was created as part of the Python Software Foundation's contribution to the Micro Bit partnership with the BBC.The source code for the project is available on GitHub. | https://en.wikipedia.org/wiki/MicroPython |
| Metal | Metal is a low-level, low-overhead hardware-accelerated 3D graphic and compute shader application programming interface (API) developed by Apple Inc., and which debuted in iOS 8. Metal combines functions similar to OpenGL and OpenCL under one API. It is intended to bring to iOS, macOS, and tvOS apps some of the performance benefits of similar APIs on other platforms, such as Vulkan (which debuted in mid-February 2016) and DirectX 12. Metal is an object-oriented API that can be invoked using the Swift or Objective-C programming languages. Full-blown control of the Metal framework (as well as the related MetalKit framework) is accessible via the Metal Unified Graphics and Compute Language. According to Apple promotional materials: "Metal is a C++ based programming language that developers can use to write code that is executed on the GPU for graphics and general-purpose data-parallel computations. Since Metal is based on C++, developers will find it familiar and easy to use. With Metal, both graphics and compute programs can be written with a single, unified language, which allows tighter integration between the two." | https://en.wikipedia.org/wiki/Metal_(API) |
| METAFONT | Metafont is a description language used to define raster fonts. It is also the name of the interpreter that executes Metafont code, generating the bitmap fonts that can be embedded into e.g. PostScript. Metafont was devised by Donald Knuth as a counterpart to his TeX typesetting system. One of the characteristics of Metafont is that all of the shapes of the glyphs are defined with geometrical equations. In particular, one can define a given point to be the intersection of a line segment and a Bézier cubic. | https://en.wikipedia.org/wiki/Metafont |
| METAPOST | MetaPost refers to both a programming language and the interpreter of the MetaPost programming language. Both are derived from Donald Knuth's Metafont language and interpreter. MetaPost produces vector graphic diagrams from a geometric/algebraic description. The language shares Metafont's declarative syntax for manipulating lines, curves, points and geometric transformations. However, Metafont is set up to produce fonts, in the form of image files (in .gf format) with associated font metric files (in .tfm format), whereas MetaPost produces EPS, SVG, or PNG files The output of Metafont consists of the fonts at a fixed resolution in a raster-based format, whereas MetaPost's output is vector-based graphics (lines, Bézier curves) Metafont output is monochrome, whereas MetaPost uses RGB or CMYK colors. The MetaPost language can include text labels on the diagrams, either strings from a specified font, or anything else that can be typeset with TeX. Starting with version 1.8, Metapost allows floating-point arithmetic with 64 bits (default: 32 bit fixed-point arithmetic)Many of the limitations of MetaPost derive from features of Metafont. For instance, MetaPost does not support all features of PostScript. Most notably, paths can have only one segment (so that regions are simply connected), and regions can be filled only with uniform colours. PostScript level 1 supports tiled patterns and PostScript 3 supports Gouraud shading. | https://en.wikipedia.org/wiki/MetaPost |
| MetaComCo | MetaComCo (MCC) was a computer systems software company started in 1981 and based in Bristol, England by Peter Mackeonis and Derek Budge. A division of Tenchstar, Ltd. MetaComCo's first product was an MBASIC compatible interpreter for IBM PCs, which was licensed by Peter Mackeonis to Digital Research in 1982, and issued as the Digital Research Personal Basic, or PBASIC, running under CP/M. Other computer languages followed, also licensed by Digital Research and MetaComCo established an office in Pacific Grove, California, to service their United States customers. In 1984 Dr. Tim King joined the company, bringing with him a version of the operating system TRIPOS for the Motorola 68000 processor which he had previously worked on whilst a researcher at the University of Cambridge. This operating system was used as the basis of AmigaDOS (file-related functions of AmigaOS); MetaComCo won the contract from Commodore because the original planned Amiga disk operating system called Commodore Amiga Operating System (CAOS) was behind schedule; timescales were incredibly tight and TRIPOS provided a head start for a replacement system. MetaComCo also developed ABasiC for the Amiga which was initially provided with Amigas. Much to Commodore's annoyance MetaComCo also worked with Atari to produce the BASIC that was initially provided with the Atari ST — ST BASIC. The company also sold the Lattice C compiler for the Sinclair QL and the Atari ST and range of other languages (e.g. Pascal, BCPL) for m68k-based computers. MetaComCo also represented LISP and REDUCE software from the RAND Corporation. Several of the team at MetaComCo went on to found Perihelion Software. Mackeonis founded Triangle Publishing, the software publishing company responsible for creating the ST Organizer for the Atari ST and PC Organizer and Counterpoint (a GUI system) for Amstrad Computers and GoldStar computers. | https://en.wikipedia.org/wiki/MetaComCo |
| Met-English | Met English Language (MEL) was an early computer language used by the Metropolitan Life Insurance Company (MetLife). It enabled MetLife to establish itself as a strong technology company in the early days of commercial computing. It has now been retired and is no longer in use. | https://en.wikipedia.org/wiki/Met_English |
| MessagePack | MessagePack is a computer data interchange format. It is a binary form for representing simple data structures like arrays and associative arrays. MessagePack aims to be as compact and simple as possible. The official implementation is available in a variety of languages such as C, C++, C#, D, Erlang, Go, Haskell, Java, JavaScript, Lua, OCaml, Perl, PHP, Python, Ruby, Scala, Smalltalk, and Swift. | https://en.wikipedia.org/wiki/MessagePack |
| Meson | Meson (/ˈmɛ.sɒn/) is a software tool for automating the building (compiling) of software. The overall goal for Meson is to promote programmer productivity.Meson is free and open-source software written in Python 3 and subject to the terms of the Apache 2.0 License. | https://en.wikipedia.org/wiki/Meson_(software) |
| Mesa | Mesa is a programming language developed in the late 1970s at the Xerox Palo Alto Research Center in Palo Alto, California, United States. The language name was a pun based upon the programming language catchphrases of the time, because Mesa is a "high level" programming language. Mesa is an ALGOL-like language with strong support for modular programming. Every library module has at least two source files: a definitions file specifying the library's interface plus one or more program files specifying the implementation of the procedures in the interface. To use a library, a program or higher-level library must "import" the definitions. The Mesa compiler type-checks all uses of imported entities; this combination of separate compilation with type-checking was unusual at the time.Mesa introduced several other innovations in language design and implementation, notably in the handling of software exceptions, thread synchronization, and incremental compilation. Mesa was developed on the Xerox Alto, one of the first personal computers with a graphical user interface, however most of the Alto's system software was written in BCPL. Mesa was the system programming language of the later Xerox Star workstations, and for the GlobalView desktop environment. Xerox PARC later developed Cedar, which was a superset of Mesa. Mesa and Cedar had a major influence on the design of other important languages, such as Modula-2 and Java, and was an important vehicle for the development and dissemination of the fundamentals of GUIs, networked environments, and the other advances Xerox contributed to the field of computer science. | https://en.wikipedia.org/wiki/Mesa_(programming_language) |
| Mercury | Mercury is a functional logic programming language made for real-world uses. The first version was developed at the University of Melbourne, Computer Science department, by Fergus Henderson, Thomas Conway, and Zoltan Somogyi, under Somogyi's supervision, and released on April 8, 1995. Mercury is a purely declarative logic programming language. It is related to both Prolog and Haskell. It features a strong, static, polymorphic type system, and a strong mode and determinism system. The official implementation, the Melbourne Mercury Compiler, is available for most Unix and Unix-like platforms, including Linux, macOS, and for Windows (32bits only). | https://en.wikipedia.org/wiki/Mercury_(programming_language) |
| Mercurial | Mercurial is a distributed revision-control tool for software developers. It is supported on Microsoft Windows and Unix-like systems, such as FreeBSD, macOS and Linux. Mercurial's major design goals include high performance and scalability, decentralized, fully distributed collaborative development, robust handling of both plain text and binary files, and advanced branching and merging capabilities, while remaining conceptually simple. It includes an integrated web-interface. Mercurial has also taken steps to ease the transition for users of other version control systems, particularly Subversion. Mercurial is primarily a command-line driven program, but graphical user interface extensions are available, e.g. TortoiseHg, and several IDEs offer support for version control with Mercurial. All of Mercurial's operations are invoked as arguments to its driver program hg (a reference to Hg - the chemical symbol of the element mercury). Matt Mackall originated Mercurial and serves as its lead developer. Mercurial is released as free software under the terms of the GNU GPL v2 (or any later version). It is mainly implemented using the Python programming language, but includes a binary diff implementation written in C. | https://en.wikipedia.org/wiki/Mercurial |
| MediaWiki | MediaWiki is a free and open-source wiki software. Originally developed by Magnus Manske and improved by Lee Daniel Crocker, it runs on many websites, including Wikipedia, Wiktionary and Wikimedia Commons. It is written in the PHP programming language and stores the contents into a database. Like WordPress, which is based on a similar licensing and architecture, it has become the dominant software in its category. The first version of the software was deployed to serve the needs of the Wikipedia encyclopedia in 2002. Wikipedia and other Wikimedia Foundation projects continue to define a large part of the requirement set for MediaWiki. The software is optimized to efficiently handle large projects, which can have terabytes of content and hundreds of thousands of hits per second. Because Wikipedia is one of the world's largest websites, achieving scalability through multiple layers of caching and database replication has been a major concern for developers. The software has more than 900 configuration settings and more than 1,900 extensions available for enabling various features to be added or changed. On Wikipedia alone, more than 1000 automated and semi-automated bots and other tools have been developed to assist in editing. It has also been deployed by some companies as an internal knowledge management system, and some educators have assigned students to use MediaWiki for collaborative group projects. | https://en.wikipedia.org/wiki/MediaWiki |
| EML | Mbox is a generic term for a family of related file formats used for holding collections of email messages, first implemented for Fifth Edition Unix. All messages in an mbox mailbox are concatenated and stored as plain text in a single file. Each message starts with the four characters "From" followed by a space (the so named "From_ line") and the sender's email address. RFC 4155 defines that a UTC timestamp follows after another separating space character. Unlike the Internet protocols used for the exchange of email, the format used for the storage of email has never been formally defined through the RFC standardization mechanism and has been entirely left to the developer of an email client. However, the POSIX standard defined a loose frame in conjunction with the mailx program. In 2005 finally, the application/mbox media type was standardized as RFC 4155, and hints that mbox stores mailbox messages in their original Internet Message (RFC 2822) format, except for the used newline character, seven-bit clean data storage, and the requirement that each newly added message is terminated with a completely empty line within the mbox database. A format similar to mbox is the MH Message Handling System. Other systems, such as Microsoft Exchange Server and the Cyrus IMAP server store mailboxes in centralised databases managed by the mail system and not directly accessible by individual users. The maildir mailbox format is often cited as an alternative to the mbox format for network email storage systems. | https://en.wikipedia.org/wiki/Mbox |
| Maxima | Maxima is a computer algebra system (CAS) based on a 1982 version of Macsyma. It is written in Common Lisp and runs on all POSIX platforms such as macOS, Unix, BSD, and Linux, as well as under Microsoft Windows and Android. It is free software released under the terms of the GNU General Public License (GPL). | https://en.wikipedia.org/wiki/Maxima_(software) |
| Max | Max, also known as Max/MSP/Jitter, is a visual programming language for music and multimedia developed and maintained by San Francisco-based software company Cycling '74. Over its more than thirty-year history, it has been used by composers, performers, software designers, researchers, and artists to create recordings, performances, and installations.The Max program is modular, with most routines existing as shared libraries. An application programming interface (API) allows third-party development of new routines (named external objects). Thus, Max has a large user base of programmers unaffiliated with Cycling '74 who enhance the software with commercial and non-commercial extensions to the program. Because of this extensible design, which simultaneously represents both the program's structure and its graphical user interface (GUI), Max has been described as the lingua franca for developing interactive music performance software. | https://en.wikipedia.org/wiki/Max_(software) |
| Apache Maven | Maven is a build automation tool used primarily for Java projects. Maven addresses two aspects of building software: first, it describes how software is built, and second, it describes its dependencies. Unlike earlier tools like Apache Ant, it uses conventions for the build procedure, and only exceptions need to be written down. An XML file describes the software project being built, its dependencies on other external modules and components, the build order, directories, and required plug-ins. It comes with pre-defined targets for performing certain well-defined tasks such as compilation of code and its packaging. Maven dynamically downloads Java libraries and Maven plug-ins from one or more repositories such as the Maven 2 Central Repository, and stores them in a local cache. This local cache of downloaded artifacts can also be updated with artifacts created by local projects. Public repositories can also be updated. Maven can also be used to build and manage projects written in C#, Ruby, Scala, and other languages. The Maven project is hosted by the Apache Software Foundation, where it was formerly part of the Jakarta Project. Maven is built using a plugin-based architecture that allows it to make use of any application controllable through standard input. Theoretically, this would allow anyone to write plugins to interface with build tools (compilers, unit test tools, etc.) for any other language. In reality, support and use for languages other than Java has been minimal. A plugin for the .NET framework exists and is maintained, and a C/C++ native plugin is maintained for Maven 2.Alternative technologies like Gradle and sbt as build tools do not rely on XML, but keep the key concepts Maven introduced. With Apache Ivy, a dedicated dependency manager was developed as well that also supports Maven repositories.Maven still does not support reproducible builds, but developers are progressing on this task. | https://en.wikipedia.org/wiki/Apache_Maven |
| Matita | Matita is an experimental proof assistant under development at the Computer Science Department of the University of Bologna. It is a tool aiding the development of formal proofs by man-machine collaboration, providing a programming environment where formal specifications, executable algorithms and automatically verifiable correctness certificates naturally coexist. Matita is based on a dependent type System known as the Calculus of (Co)Inductive Constructions (a derivative of Calculus of Constructions), and is compatible, to some extent, with Coq. The word "matita" means "pencil" in Italian (a simple and widespread editing tool). It is a reasonably small and simple application, whose architectural and software complexity is meant to be mastered by students, providing a tool particularly suited for testing innovative ideas and solutions. Matita adopts a tactic-based editing mode; (XML-encoded) proof objects are produced for storage and exchange. | https://en.wikipedia.org/wiki/Matita |
| Mathcad | Mathcad is computer software primarily intended for the verification, validation, documentation and re-use of engineering calculations. First introduced in 1986 on DOS, it was the first to introduce live editing of typeset mathematical notation, combined with its automatic computations. | https://en.wikipedia.org/wiki/Mathcad |
| MXF | Material Exchange Format (MXF) is a container format for professional digital video and audio media defined by a set of SMPTE standards. A typical example of its use is for delivering advertisements to TV stations and tapeless archiving of broadcast TV programs. | https://en.wikipedia.org/wiki/Material_Exchange_Format |
| Mary | Mary was a programming language designed and implemented by RUNIT at Trondheim, Norway in the 1970s. It borrowed many features from ALGOL 68 but was designed for machine-oriented programming. An unusual feature of its syntax was that expressions were constructed using the conventional infix operators, but all of them had the same precedence and evaluation went from left to right unless there were brackets. Assignment had the destination on the right and assignment was considered just another operator. Similar to C, several language features appear to have existed to allow programmers to produce reasonably well optimised code, despite a quite primitive code generator in the compiler. These included operators similar to the += et alter in C and explicit register declarations for variables. Notable features: "Dataflow syntax" - values flow from left to right, including assignment. Most constructs could be used in expressions (blocks, IF, CASE, etc.). Text-based recursive macros. Overloaded user-defined operators, not constrained to predefined identifiers as in C++. Automatic building and dereferencing of pointers from type context. Scalar range types. Array and set enumeration in loop iterators. Dynamic array descriptors (ROW).A book describing Mary was printed in 1974 (Fourth and last edition in 1979): Mary Textbook by Reidar Conradi & Per Holager. Compilers were made for Kongsberg Våpenfabrikk's SM-4 and Norsk Data Nord-10/ND-100 mini-computers. The original Mary compiler was written in NU ALGOL, ran on the Univac-1100 series and was used to bootstrap a native compiler for ND-100/SINTRAN-III. RUNIT implemented a CHILL compiler written in Mary which ran on ND-100 and had Intel 8086 and 80286 targets. When this compiler was ported to the VAX platform, a common backend for Mary and CHILL was implemented. Later, backends for i386 and SPARC were available. Since the Mary compiler was implemented in Mary, it was possible to run the compiler on all these platforms. Mary is no longer maintained. | https://en.wikipedia.org/wiki/Mary_(programming_language) |
| Markdown | Markdown is a lightweight markup language with plain text formatting syntax. It is designed so that it can be converted to HTML and many other formats using a tool by the same name. Markdown is often used to format readme files, for writing messages in online discussion forums, and to create rich text using a plain text editor. As the initial description of Markdown contained ambiguities and unanswered questions, many implementations and extensions of Markdown appeared over the years to answer these issues. | https://en.wikipedia.org/wiki/Markdown |
| MariaDB | MariaDB is a community-developed fork of the MySQL relational database management system intended to remain free under the GNU GPL. Development is led by some of the original developers of MySQL, who forked it due to concerns over its acquisition by Oracle Corporation.MariaDB intends to maintain high compatibility with MySQL, ensuring a drop-in replacement capability with library binary parity and exact matching with MySQL APIs and commands. It includes the XtraDB storage engine for replacing InnoDB, as well as a new storage engine, Aria, that intends to be both a transactional and non-transactional engine perhaps even included in future versions of MySQL.Its lead developer is Michael "Monty" Widenius, one of the founders of MySQL AB and the founder of Monty Program AB. On 16 January 2008, MySQL AB announced that it had agreed to be acquired by Sun Microsystems for approximately $1 billion. The acquisition completed on 26 February 2008. MariaDB is named after Monty's younger daughter Maria, similar to how MySQL is named after his other daughter My. | https://en.wikipedia.org/wiki/MariaDB |
| Maple | Maple is a symbolic and numeric computing environment, and is also a multi-paradigm programming language. Developed by Maplesoft, Maple also covers other aspects of technical computing, including visualization, data analysis, matrix computation, and connectivity. A toolbox, MapleSim, adds functionality for multidomain physical modeling and code generation. | https://en.wikipedia.org/wiki/Maple_(software) |
| MapBasic | MapBasic is a programming language for creation of additional tools and functionality for the MapInfo Professional geographical information system. MapBasic is based on the BASIC family of programming languages.MapBasic also allows programmers to develop software in popular programming languages such as C, C++ and Visual Basic and use these with the MapInfo Professional GIS to create geographically based software, such as electronic mapping. | https://en.wikipedia.org/wiki/MapBasic |
| Mama | Mama is an object-oriented educational programming language designed to help young students start programming by providing all language elements in the student mother tongue. Mama programming language is available in several languages, with both left-to-right (LTR) and right-to-left (RTL) language direction support. A new variant of Mama was built on top of Carnegie Mellon's Alice development environment, supporting scripting of the 3D stage objects. This new variant of Mama was designed to help young students start programming by building 3D animations and games. | https://en.wikipedia.org/wiki/Mama_%28software%29 |
| Mallard BASIC | Mallard BASIC is a BASIC interpreter for CP/M written by Locomotive Software and supplied with the Amstrad PCW range of small business computers, the ZX Spectrum +3 version of CP/M Plus, and the Acorn BBC Micro Z80 second Processor. In the 1980s, it was standard industry practice to bundle a BASIC interpreter with microcomputers, and the PCW followed this practice. While it was primarily a wordprocessor for business use, it was not a dedicated WP: it also ran the CP/M operating system. Though there were existing implementations of BASIC for CP/M, such as Digital Research's CBASIC and the third-party ZBasic, they followed the earlier 1970s model of compilers, fed source code prepared in a separate text editor. Mallard was more like a traditional micro ROM BASIC, with an integrated editor which was tailored for the PCW's non-standard 90-column screen. Although the PCW actually had excellent monochrome graphics support for its time and specification, closely comparable to the Hercules Graphics Card for the PC, Mallard BASIC had no graphics support whatsoever. Instead, Locomotive optimised it for business use, with, for instance, full ISAM random-access file support, making it easier to write database applications. It was also optimised for speed – it is named after the LNER A4 class 4468 Mallard locomotive, the fastest steam locomotive in the world, once again displaying the company's fondness for railway-oriented nomenclature. (For instance, see the company name itself.) In fact the Locomotive name came from the phrase "To run like a train" and it was this theme that was used to name Mallard BASIC – no other Locomotive product was named after anything railway-oriented. The Acorn version was designed simply to run the Compact Software small business accounting products Acorn was including to target its Z80 second processor at small businesses. Mallard's major innovation designed specifically for Acorn was the addition of the Jetsam B*-tree keyed access filing system to give similar (but superior) features to the Miksam product Compact had originally designed around. Graphics could be implemented by loading the GSX extension to CP/M, but this was cumbersome for BASIC programmers. The lack of graphics support was rectified by several BASIC toolkits, of which the most popular was LEB: Lightning Extended BASIC. This patched Mallard BASIC, replacing the redundant LET keyword with LEB, which could be followed by a wide variety of parameters to allow sophisticated graphics (for the time) to be drawn on screen, saved to disc, printed, et cetera. Probably the most widespread Mallard application ever was RPED, the text editor supplied with the PCW. The name was short for Roland Perry's EDitor, the program being put together quickly by Roland Perry, the Amstrad executive running the computer product development, when it was realised that CP/M-80 came with no usable full-screen editor, but users had a requirement to edit configuration files. The same problem was apparent with DOS Plus and MS-DOS supplied with IBM-compatible Amstrad computers, but the RPED for those machines was written in 8086 assembler, and not Mallard BASIC. The PC version of Mallard Basic is still available from LocoScript Software as an MS-DOS program which will run under Windows as a Disc only version with licence or with the full Introduction & Reference manual. | https://en.wikipedia.org/wiki/Mallard_BASIC |
| Malbolge | Malbolge () is a public domain esoteric programming language invented by Ben Olmstead in 1998, named after the eighth circle of hell in Dante's Inferno, the Malebolge. Malbolge was specifically designed to be almost impossible to use, via a counter-intuitive 'crazy operation', base-three arithmetic, and self-altering code. It builds on the difficulty of earlier, challenging esoteric languages (such as Brainfuck and Befunge), but takes this aspect to the extreme, playing on the entangled histories of computer science and encryption. Despite this design, it is possible (though very difficult) to write useful Malbolge programs. | https://en.wikipedia.org/wiki/Malbolge |
| MakeDoc | MakeDoc is a lightweight markup language created in 2000 by Carl Sassenrath for creating documentation and web pages using simple text notations. The language is used extensively in the REBOL community for documentation, websites, and wikis. | https://en.wikipedia.org/wiki/MakeDoc |
| MAGMA | Magma is a computer algebra system designed to solve problems in algebra, number theory, geometry and combinatorics. It is named after the algebraic structure magma. It runs on Unix-like operating systems, as well as Windows. | https://en.wikipedia.org/wiki/Magma_(computer_algebra_system) |
| Magik | Magik is an object-oriented programming language that supports multiple inheritance, polymorphism and is dynamically typed. It was designed implemented in 1989 by Arthur Chance, of Smallworld Systems Ltd, as part of Smallworld Geographical Information System (GIS). Following Smallworld's acquisition in 2000, Magik is now is provided by GE Energy, still as part of its Smallworld technology platform. Magik (Inspirational Magik) was originally introduced in 1990 and has been improved and updated over the years. Its current version is 5.1. In July 2012, Magik developers announced that they were in the process of porting Magik language on the Java virtual machine. The successful porting was confirmed by Oracle Corporation in November of the same year. | https://en.wikipedia.org/wiki/Magik_(programming_language) |
| Project MAC’s SYmbolic MAnipulator | Macsyma (Project MAC’s SYmbolic MAnipulator) is one of the oldest general purpose computer algebra systems which is still widely used. It was originally developed from 1968 to 1982 at MIT's Project MAC. In 1982, Macsyma was licensed to Symbolics and became a commercial product. In 1992, Symbolics Macsyma was spun off to Macsyma, Inc., which continued to develop Macsyma until 1999. That version is still available for Microsoft's Windows XP operating system. The 1982 version of MIT Macsyma remained available to academics and US government agencies, and it is distributed by the US Department of Energy (DOE). That version, DOE Macsyma, was maintained by Bill Schelter. Under the name of Maxima, it was released under the GPL in 1999, and remains under active maintenance. | https://en.wikipedia.org/wiki/MACSYMA |
| MacroML | MacroML is an experimental programming language based on the ML programming language family that seeks to reconcile ML's static typing systems, and the types of macro systems more commonly found in dynamically typed languages like Scheme; this reconciliation is difficult as macro transformations are typically Turing-complete and so can break the type safety guarantees static typing is supposed to provide. | https://en.wikipedia.org/wiki/MacroML |
| MACRO | Macro (or MACRO) may refer to: | https://en.wikipedia.org/wiki/Macro |
| MacBASIC | Macintosh Basic, or MacBASIC, was both a comprehensive programming language and a fully interactive development environment designed by Apple Inc. for the original Macintosh computer. It was developed by original Macintosh team member Donn Denman, with help from fellow Apple programmers Marianne Hsiung, Larry Kenyon, and Bryan Stearns, as part of the original Macintosh development effort starting in late 1981.MacBASIC was released as beta software in 1985, and was adopted for use in places such as the Dartmouth College computer science department, for use in an introductory programming course. In November 1985, Apple abruptly ended the project as part of a deal with Microsoft to extend the license for BASIC on the Apple II. Although Apple retracted MacBASIC, unlicensed copies of the software and manual still circulated, but because MacBASIC was no longer supported by Apple and not designed to be 32-bit-clean, interest eventually died out. Benchmarks published in the April 1984 issue of BYTE magazine suggested that MacBASIC had better performance as compared to Microsoft BASIC. The language included modern looping control structures, user-defined functions, graphics, and access to the Macintosh Toolbox. The development environment supported multiple programs running simultaneously with symbolic debugging including breakpoints and single-step execution. | https://en.wikipedia.org/wiki/MacBASIC |
| MXML | MXML is an XML-based user interface markup language first introduced by Macromedia in March 2004. Application developers use MXML in combination with ActionScript to develop rich Internet applications, with products such as Apache Flex. Adobe Systems, which acquired Macromedia in December 2005, gives no official meaning for the acronym MXML. Some developers suggest it should stand for "Magic eXtensible Markup Language" (which is a backronym). It is likely that the name comes from the MX suffix given to Macromedia Studio products released in 2002 and 2004, or simply "Macromedia eXtensible Markup Language". MXML is used mainly to declaratively lay out the interface of applications and can also be used to implement business logic and internet application behaviors. It can contain chunks of ActionScript code, either when creating the body of an event handler function, or with data binding where the curly braces ({) syntax is used. MXML is often used with Flex Server, which dynamically compiles it into standard binary SWF files. However, the Adobe Flash Builder IDE (formerly Adobe Flex Builder) and free Flex SDK can also compile MXML into SWF files without the use of a Flex Server. There is also a PHP PEAR package called XML_MXML, which is a framework to build Adobe Flex applications. MXML is considered a proprietary standard due to its tight integration with Adobe technologies. It is like XAML in this respect. No published translators exist for converting an MXML document to another user interface language such as UIML, XUL, XForms, XAML, or SVG. However, there do exist third party vendor plugins for Flex Builder that are capable of generating a result other than a SWF file from Flex applications, for instance native mobile applications. | https://en.wikipedia.org/wiki/MXML |
| MVEL | MVFLEX Expression Language (MVEL) is a hybrid dynamic/statically typed, embeddable Expression Language and runtime for the Java Platform. Originally started as a utility language for an application framework, the project is now developed completely independently. MVEL is typically used for exposing basic logic to end-users and programmers through configuration such as XML files or annotations. It may also be used to parse simple JavaBean expressions. The runtime allows MVEL expressions to be executed either interpretively, or through a pre-compilation process with support for runtime bytecode generation to remove overhead. Since MVEL is meant to augment Java-based software, it borrows most of its syntax directly from the Java programming language with some minor differences and additional capabilities. For example: as a side effect of MVEL's typing model, which treats class and method references as regular variables, it is possible to use both class and function pointers (but only for static methods). MVEL also allows collections to be represented as folds (or projections) in a Lisp-like syntax. | https://en.wikipedia.org/wiki/MVEL |
| MUSIC/SP | MUSIC/SP (Multi-User System for Interactive Computing/System Product; originally "McGill University System for Interactive Computing") was developed at McGill University in the 1970s from an early IBM time-sharing system called RAX (Remote Access Computing System). The system ran on IBM S/360, S/370, and 4300-series mainframe hardware, and offered novel features (for the time) such as file access control and data compression. It was designed to allow academics and students to create and run their programs interactively on terminals, in an era when most mainframe computing was still being done from punched cards. Over the years, development continued and the system evolved to embrace email, the Internet and eventually the World Wide Web. At its peak in the late 1980s, there were over 250 universities, colleges and high school districts that used the system in North and South America, Europe and Asia. | https://en.wikipedia.org/wiki/MUSIC/SP |
| MUMPS | MUMPS (Massachusetts General Hospital Utility Multi-Programming System), or M, is a general-purpose computer programming language that provides ACID (Atomic, Consistent, Isolated, and Durable) transaction processing. Its differentiating feature is its "built-in" database, enabling high-level access to disk storage using simple symbolic program variables and subscripted arrays, similar to the variables used by most languages to access main memory. The M database is a key-value database engine optimized for high-throughput transaction processing. As such it is in the class of "schema-less", "schema-free," or NoSQL databases. Internally, M stores data in multidimensional hierarchical sparse arrays (also known as key-value nodes, sub-trees, or associative memory). Each array may have up to 32 subscripts, or dimensions. A scalar can be thought of as an array element with zero subscripts. Nodes with varying numbers of subscripts (including one node with no subscripts) can freely co-exist in the same array. Perhaps the most unusual aspect of the M language is the notion that the database is accessed through variables, rather than queries or retrievals. This means that accessing volatile memory and non-volatile storage use the same basic syntax, enabling a function to work on either local (volatile) or global (non-volatile) variables. Practically, this provides for extremely high performance data access. Originally designed in 1966 for the healthcare industry, M continues to be used today by many large hospitals and banks to provide high-throughput transaction data processing. | https://en.wikipedia.org/wiki/MUMPS |
| MSX BASIC | MSX BASIC is a dialect of the BASIC programming language. It is an extended version of Microsoft Standard BASIC Version 4.5, and includes support for graphic, music, and various peripherals attached to MSX Personal Computers. Generally, MSX-BASIC is designed to follow GW-BASIC, which is one of the standard BASICs running on 16-bit computers. During the creation of MSX-BASIC, effort was made to make the system flexible and expandable. | https://en.wikipedia.org/wiki/MSX_BASIC |
| Message Queuing Telemetry Transport | MQTT (Message Queuing Telemetry Transport) is an ISO standard (ISO/IEC PRF 20922) publish-subscribe-based messaging protocol. It works on top of the TCP/IP protocol. It is designed for connections with remote locations where a "small code footprint" is required or the network bandwidth is limited. The publish-subscribe messaging pattern requires a message broker. Andy Stanford-Clark of IBM and Arlen Nipper of Cirrus Link authored the first version of the protocol in 1999.In 2013, IBM submitted MQTT v3.1 to the OASIS specification body with a charter that ensured only minor changes to the specification could be accepted. MQTT-SN is a variation of the main protocol aimed at embedded devices on non-TCP/IP networks, such as Zigbee. Historically, the "MQ" in "MQTT" came from the IBM MQ (then 'MQSeries') message queuing product line. However, queuing itself is not required to be supported as a standard feature in all situations.Alternative message-oriented middleware includes the Advanced Message Queuing Protocol (AMQP), Streaming Text Oriented Messaging Protocol (STOMP), the IETF Constrained Application Protocol, XMPP, DDS, OPC UA, and Web Application Messaging Protocol (WAMP). | https://en.wikipedia.org/wiki/MQTT |
| MQL5 | MQL4 (MetaQuotes Language 4) and MQL5 (MetaQuotes Language 5) are integrated programming languages designed for developing trading robots, technical market indicators, scripts and function libraries within the MetaTrader software. The primary objective of MQL4 and MQL5 is automation of trading and facilitation of operational analysis. MQL4 and MQL5 comprises an extensive codebase source code library used for developing trading robots. | https://de.wikipedia.org/wiki/MetaQuotes_Language_MQL4/MQL5 |
| MMX instruction set | MMX is a single instruction, multiple data (SIMD) instruction set designed by Intel, introduced in 1997 with its P5-based Pentium line of microprocessors, designated as "Pentium with MMX Technology". It developed out of a similar unit introduced on the Intel i860, and earlier the Intel i750 video pixel processor. MMX is a processor supplementary capability that is supported on recent IA-32 processors by Intel and other vendors. MMX has subsequently been extended by several programs by Intel and others: 3DNow!, Streaming SIMD Extensions (SSE), and ongoing revisions of Advanced Vector Extensions (AVX). | https://en.wikipedia.org/wiki/MMX_(instruction_set) |
| ML | ML ('Meta Language') is a general-purpose functional programming language. It has roots in Lisp, and has been characterized as "Lisp with types". It is known for its use of the polymorphic Hindley–Milner type system, which automatically assigns the types of most expressions without requiring explicit type annotations, and ensures type safety – there is a formal proof that a well-typed ML program does not cause runtime type errors. ML provides pattern matching for function arguments, garbage collection, imperative programming, call-by-value and currying. It is used heavily in programming language research and is one of the few languages to be completely specified and verified using formal semantics. Its types and pattern matching make it well-suited and commonly used to operate on other formal languages, such as in compiler writing, automated theorem proving and formal verification. | https://en.wikipedia.org/wiki/ML_(programming_language) |
| MIPS architecture | MIPS is a reduced instruction set computer (RISC) instruction set architecture (ISA) developed by MIPS Technologies (formerly MIPS Computer Systems). The early MIPS architectures were 32-bit, with 64-bit versions added later. There are multiple versions of MIPS: including MIPS I, II, III, IV, and V; as well as five releases of MIPS32/64 (for 32- and 64-bit implementations, respectively). As of April 2017, the current version is MIPS32/64 Release 6. MIPS32/64 primarily differs from MIPS I–V by defining the privileged kernel mode System Control Coprocessor in addition to the user mode architecture. Several optional extensions are also available, including MIPS-3D which is a simple set of floating-point SIMD instructions dedicated to common 3D tasks, MDMX (MaDMaX) which is a more extensive integer SIMD instruction set using the 64-bit floating-point registers, MIPS16e which adds compression to the instruction stream to make programs take up less room, and MIPS MT, which adds multithreading capability. Computer architecture courses in universities and technical schools often study the MIPS architecture. The architecture greatly influenced later RISC architectures such as Alpha. As of April 2017, MIPS processors are used in embedded systems such as residential gateways and routers. Originally, MIPS was designed for general-purpose computing, and during the 1980s and 1990s, MIPS processors for personal, workstation, and server computers were used by many companies such as Digital Equipment Corporation, MIPS Computer Systems, NEC, Pyramid Technology, SiCortex, Siemens Nixdorf, Silicon Graphics, and Tandem Computers. Historically, video game consoles such as the Nintendo 64, Sony PlayStation, PlayStation 2 and PlayStation Portable use MIPS processors. MIPS processors also used to be popular in supercomputers during the 1990s, but all such systems have dropped off the TOP500 list. These uses were complemented by embedded applications at first, but during the 1990s, MIPS became a major presence in the embedded processor market, and by the 2000s, most MIPS processors were for these applications. In the mid- to late-1990s, it was estimated that one in three RISC microprocessors produced was a MIPS processor. MIPS is a modular architecture supporting up to four coprocessors (CP0/1/2/3). In MIPS terminology, CP0 is the System Control Coprocessor (an essential part of the processor that is implementation-defined in MIPS I–V), CP1 is an optional floating-point unit (FPU) and CP2/3 are optional implementation-defined coprocessors (MIPS III removed CP3 and reused its opcodes for other purposes). For example, in the PlayStation video game console, CP2 is the Geometry Transformation Engine (GTE), which accelerates the processing of geometry in 3D computer graphics. | https://en.wikipedia.org/wiki/MIPS_architecture |
| MINC | MINC ("MINC is not C") is a data specification language written in the mid-1980s by a Princeton University graduate student named Lars Graf. This kind of naming is known as a "recursive acronym". It contains many (though not all) of the syntactical capabilities of the C programming language, and can be used to implement simple procedural programs that can be executed by a runtime parser (that is to say, MINC does not need to be compiled in any way). MINC continues to be used only in a handful of programs written in the 1980s (e.g. Real-Time Cmix). It has been for all intents and purposes superseded by modern scripting languages such as Perl, Python, and Tcl. A controversial aspect of the language is whether it is pronounced "mink" or "min-see". | https://en.wikipedia.org/wiki/MINC |
| MIMIC | MIMIC, known in capitalized form only, is a former simulation computer language developed 1964 by H. E. Petersen, F. J. Sansom and L. M. Warshawsky of Systems Engineering Group within the Air Force Materiel Command at the Wright-Patterson AFB in Dayton, Ohio, United States. It is an expression-oriented continuous block simulation language, but capable of incorporating blocks of FORTRAN-like algebra. MIMIC is a further development from MIDAS (Modified Integration Digital Analog Simulator), which represented analog computer design. Written completely in FORTRAN but one routine in COMPASS, and ran on Control Data supercomputers, MIMIC is capable of solving much larger simulation models. With MIMIC, ordinary differential equations describing mathematical models in several scientific disciplines as in engineering, physics, chemistry, biology, economics and as well as in social sciences can easily be solved by numerical integration and the results of the analysis are listed or drawn in diagrams. It also enables the analysis of nonlinear dynamic conditions. The MIMIC software package, written as FORTRAN overlay programs, executes input statements of the mathematical model in six consecutive passes. Simulation programs written in MIMIC are compiled rather than interpreted. The core of the simulation package is a variable step numerical integrator of fourth-order Runge-Kutta method. Many useful functions related to electrical circuit elements exist besides some mathematical functions found in most scientific programming languages. There is no need to sort the statements in order of dependencies of the variables, since MIMIC does it internally. Parts of the software organized in overlays are: MIMIN (input)– reads in user simulation program and data, MIMCO (compiler) – compiles the user program and creates an in-core array of instructions, MIMSO (sort)– sorts the instructions array after dependencies of variables, MIMAS (assembler) – converts the BCD instructions into machine-oriented code, MIMEX (execute)– executes the user program by integrating, MIMOUT (output)– puts out the data as a list or diagram of data. | https://en.wikipedia.org/wiki/MIMIC |
| Meditech Interpretive Information System | MIIS (Meditech Interpretive Information System) is a MUMPS-like programming language that was created by A.Neil Pappalardo and Curt W. Marble, on a DEC PDP at Mass General Hospital from 1964 to 1968. MUMPS evolution took two major directions: MUMPS proper and MIIS. MUMPS became an ANSI and ISO-standard language. When many MUMPS implementations standardized to be compatible, MIIS did not standardize, but became a proprietary system instead. As an example of the differences between MUMPS and MIIS, the value of a logical expression in MUMPS may be false = zero (0) or true = non-zero, canonically, one (1). In MIIS, the value false is the empty string and the value of true is a string consisting of the ASCII delete character (code 127 decimal). There is also a philosophical difference between the dialects. MIIS often takes the approach that code should march along, regardless of possible errors, where MUMPS will error out to prevent more serious problems. For example, when encountering an undefined variable, MUMPS generates an error where MIIS treats it as nil. In the 1980s Brigham and Women's Hospital in Massachusetts used MIIS to program their Data General Mainframe. In 1986, SCAMC reported that Vancouver General Hospital also had an Integrated Cardiology Patient Management System written in MIIS. The MIIS language has been used in programming library systems as well as health industry systems. The OCLC's library system is one example. It has also been used to create financial systems for insurance brokers, as seen in Ireland and the UK in the late 1970s. | https://en.wikipedia.org/wiki/MIIS_(programming_language) |
| MHEG-5 | MHEG-5, or ISO/IEC 13522-5, is part of a set of international standards relating to the presentation of multimedia information, standardised by the Multimedia and Hypermedia Experts Group (MHEG). It is most commonly used as a language to describe interactive television services. | https://en.wikipedia.org/wiki/MHEG-5 |
| Meta II | META II is a domain-specific programming language for writing compilers. It was created in 1963-1964 by Dewey Val Schorre at UCLA. META II uses what Schorre called syntax equations. Its operation is simply explained as: Each syntax equation is translated into a recursive subroutine which tests the input string for a particular phrase structure, and deletes it if found. Meta II programs are compiled into an interpreted byte code language. VALGOL and SMALGOL compilers illustrating its capabilities were written in the META II language, VALGOL is a simple algebraic language designed for the purpose of illustrating META II. SMALGOL was a fairly large subset of ALGOL 60. | https://en.wikipedia.org/wiki/META_II |
| MEDUSA | MEDUSA, (since 2004 MEDUSA4) is a CAD program used in the areas of mechanical and plant engineering by manufacturers and Engineering, Procurement and Construction (EPC) companies. The system's history is closely tied to the beginnings of mainstream CAD and the research culture fostered by Cambridge University and the UK government as well as the resulting transformation of Cambridge into a world-class tech centre in the 1980s. | https://en.wikipedia.org/wiki/MEDUSA |
| MDL | MDL (the MIT Design Language) is a descendant of the Lisp programming language. Its initial purpose was to provide high level language support for the Dynamic Modeling Group at MIT's Project MAC. It was initially developed in 1971 on the PDP-10 computer under the Incompatible Timesharing System. The initial development team consisted of Gerald Sussman and Carl Hewitt of the Artificial Intelligence Lab, and Chris Reeve, Bruce Daniels, and David Cressey of the Dynamic Modeling Group. Later, Stu Galley, also of the Dynamic Modeling Group, wrote the MDL documentation.MDL was initially known as "Muddle". This style of self-deprecating humor was not widely understood or appreciated outside of Project MAC and a few other early citadels of information technology. So the name was sanitized to MDL.MDL provides several enhancements to classical Lisp. It supports several built-in data types, including lists, strings and arrays, and user-defined data types. It offers multithreaded expression evaluation and coroutines. Variables can carry both a local value within a scope, and a global value, for passing data between scopes. Advanced built-in functions supported interactive debugging of MDL programs, incremental development, and reconstruction of source programs from object programs. Although MDL is obsolete, some of its features have been incorporated in later versions of Lisp. Gerald Sussman went on to develop the Scheme language, in collaboration with Guy Steele, who later wrote the specifications for Common Lisp and Java. Carl Hewitt had already published the idea for the PLANNER language before the MDL project began, but his subsequent thinking on PLANNER reflected lessons learned from building MDL. Planner concepts influenced languages such as Prolog and Smalltalk. Smalltalk and Simula, in turn, influenced his future work on the Actor model. But the largest influence that MDL had was on the genre known as interactive fiction. An interactive fiction game known as Zork, sometimes called Dungeon, was first written in MDL. Later, Reeve, Daniels, Galley and other members of Dynamic Modeling went on to start Infocom, a company that produced many early commercial works of interactive fiction. | https://en.wikipedia.org/wiki/MDL_(programming_language) |
| MBASIC | MBASIC is the Microsoft BASIC implementation of BASIC for the CP/M operating system. MBASIC is a descendant of the original Altair BASIC interpreters that were among Microsoft's first products. MBASIC was one of the two versions of BASIC bundled with the Osborne 1 computer. The name "MBASIC" is derived from the disk file name MBASIC.COM of the BASIC interpreter. | https://en.wikipedia.org/wiki/MBASIC |
| MATLAB | MATLAB (matrix laboratory) is a multi-paradigm numerical computing environment. A proprietary programming language developed by MathWorks, MATLAB allows matrix manipulations, plotting of functions and data, implementation of algorithms, creation of user interfaces, and interfacing with programs written in other languages, including C, C++, C#, Java, Fortran and Python. Although MATLAB is intended primarily for numerical computing, an optional toolbox uses the MuPAD symbolic engine, allowing access to symbolic computing abilities. An additional package, Simulink, adds graphical multi-domain simulation and model-based design for dynamic and embedded systems. As of 2017, MATLAB has over 2 million users across industry and academia. MATLAB users come from various backgrounds of engineering, science, and economics. | https://en.wikipedia.org/wiki/MATLAB |
| MATHLAB | MATHLAB is a computer algebra system created in 1964 by Carl Engelman at MITRE and written in Lisp. "MATHLAB 68" was introduced in 1967 and became rather popular in university environments running on DECs PDP-6 and PDP-10 under TOPS-10 or TENEX. In 1969 this version was included in the DECUS user group's library (as 10-142) as royalty-free software. Carl Engelman left MITRE for Symbolics where he contributed his expert knowledge in the development of Macsyma. | https://en.wikipedia.org/wiki/MATHLAB |
| MATH-MATIC | MATH-MATIC is the marketing name for the AT-3 (Algebraic Translator 3) compiler, an early programming language for the UNIVAC I and UNIVAC II. MATH-MATIC was written beginning around 1955 by a team led by Charles Katz under the direction of Grace Hopper. A preliminary manual was produced in 1957 and a final manual the following year. Syntactically, MATH-MATIC was similar to Univac's contemporaneous business-oriented language, FLOW-MATIC, differing in providing algebraic-style expressions and floating-point arithmetic, and arrays rather than record structures. | https://en.wikipedia.org/wiki/MATH-MATIC |
| MARK IV | MARK IV is a Fourth-generation programming language that was created by Informatics, Inc. in the 1960s. Informatics took advantage of IBM's decision to unbundle their software; MARK IV was the first "software product to have cumulative sales of $10 million". MARK IV was developed for IBM Systems (360 and 370) and for the RCA Spectra 70. Its main benefit was allowing faster application development on the order of 6 to 10 times faster than doing a system using a 3GL, such as COBOL. MARK IV, being an early 4GL, allowed user development of systems related to business. In a 1971 ad by Informatics, there are several quotes from customers, such as: We conservatively estimate that the benefits derived from the MARK IV System have completely returned the cost of our investment in a period of less than 3 months. MARK IV runs ... handle Accounts Receivable, Inventory, Sales Analyses, etc. on about 26 different factories.MARK IV went to Sterling Software in 1985 as part of that company's acquisition of Informatics General. As VISION:BUILDER it is now part of the product suite from Computer Associates. | https://en.wikipedia.org/wiki/MARK_IV_(software) |
| MARIA XML | MARIA (Model-based lAnguage foR Interactive Applications) is a universal, declarative, multiple abstraction level, XML-based user interface markup language for modelling interactive applications in ubiquitous environments. MARIA one of the languages that has been submitted for standardization at W3C. | https://en.wikipedia.org/wiki/MARIA_XML |
| MAI Basic Four | MAI Basic Four (sometimes written as Basic/Four Corporation or Basic 4) refers to a variety of Business Basic, the computers that ran it, and the company that sold them (its name at various times given as MAI Basic Four Inc., MAI Basic Four Information Systems, and MAI Systems Corporation). MAI Systems Corporation became a wholly owned subsidiary of Softbrands Inc. in 2006. Basic/Four Corporation was created as a subsidiary of Management Assistance, Inc. in Irvine, California. Basic/Four sold small business minicomputers that were assembled from Microdata Corporation CPUs. MAI Basic Four Business Basic was one of the first commercially available business BASIC interpreters. MAI Basic Four (the company) originally sold minicomputers but later offered superminicomputers and microcomputers. The computers ran an operating system with the BASIC interpreter integrated. In 1985, Wall Street financier Bennett S. LeBow purchased the company after it had experienced significant operating financial losses. In 1988, LeBow used the company as a platform for an unsuccessful attempted hostile takeover of much larger Prime Computer.The company released accounting software for third-party microcomputers in the mid 1980's. In 1988 it released its own 80286-based workstation. The Basic4 system was utilized by many small banks and credit unions. In 1990 the company changed its name to MAI Systems Corp. and changed its business to be a system integrator instead of a combined hardware and software manufacturer, reselling third-party computers but installing their own customer-specific software system. | https://en.wikipedia.org/wiki/MAI_Basic_Four |
| Michigan Algorithm Decoder | MAD (Michigan Algorithm Decoder) is a programming language and compiler for the IBM 704 and later the IBM 709, IBM 7090, IBM 7040, UNIVAC 1107, UNIVAC 1108, Philco 210-211, and eventually the IBM S/370 mainframe computers. Developed in 1959 at the University of Michigan by Bernard Galler, Bruce Arden and Robert M. Graham, MAD is a variant of the ALGOL language. It was widely used to teach programming at colleges and universities during the 1960s and played a minor role in the development of CTSS, Multics, and the Michigan Terminal System computer operating systems. The archives at the Bentley Historical Library of the University of Michigan contain reference materials on the development of MAD and MAD/I, including three linear feet of printouts with hand-written notations and original printed manuals. | https://en.wikipedia.org/wiki/MAD_(programming_language) |
| MACRO-11 | MACRO-11 is an assembly language with macro facilities for PDP-11 minicomputers from Digital Equipment Corporation (DEC). It is the successor to PAL-11 (Program Assembler Loader), an earlier version of the PDP-11 assembly language without macro facilities. The MACRO-11 assembly language was designed for the PDP-11 minicomputer family. It was supported on all DEC PDP-11 operating systems. PDP-11 Unix systems also include an assembler (called "as"), structurally similar to MACRO-11 but with different syntax and fewer features. | https://en.wikipedia.org/wiki/MACRO-11 |
| MACRO-10 | MACRO-10 is an assembly language with extensive macro facilities for DEC's PDP-10-based Mainframe computer systems, the DECsystem-10 and the DECSYSTEM-20. MACRO-10 is implemented as a two-pass assembler. | https://en.wikipedia.org/wiki/MACRO-10 |
| M2001 | M2001 is a modular educational mathematical programming language for developing and presenting mathematical algorithms, from the modern discrete to the classical continuous mathematics. M2001 is built on a semantic framework that is based in category theory and has a syntax similar to that of Pascal or Modula-2. It is designed purely for pedagogic use, so efficiency and ease of implementation have been far less important in its development than generality and range of application. It was created to play an important role in forming a formal algorithmic foundation for first-year college math students. | https://en.wikipedia.org/wiki/M2001 |
| Lynx | Lynx is a programming language for large distributed networks, using remote procedure calls. It was developed by the University of Wisconsin–Madison in 1984 for the Charlotte multicomputer operating system. In 1986 at the University of Rochester Lynx was ported to the Chrysalis operating system running on a BBN Butterfly multiprocessor. | https://en.wikipedia.org/wiki/Lynx_(programming_language) |
| LyX | LyX (styled as L Y X {\displaystyle \mathbf {L} \!{}_{\mathbf {\displaystyle Y} }\!\mathbf {X} } ; pronounced [ˈlɪks]) is an open source document processor based on the LaTeX typesetting system. Unlike most word processors, which follow the WYSIWYG ("what you see is what you get") paradigm, LyX has a WYSIWYM ("what you see is what you mean") approach, where what shows up on the screen is only an approximation of what will show up on the page. Since LyX largely functions as a front-end to the LaTeX typesetting system, it has the power and flexibility of LaTeX, and can handle documents including books, notes, theses, to academic papers, letters, etc. Knowledge of the LaTeX markup language is not necessary for basic usage, although a variety of specialized formatting is only possible by adding LaTeX directives directly into the page. LyX is popular among technical authors and scientists for its advanced mathematical modes, though it is increasingly used by non-mathematically-oriented scholars as well for its bibliographic database integration and ability to manage multiple files. LyX has also become popular among self-publishers.LyX is available for various operating systems, including Windows, macOS, Linux, UNIX, OS/2 and Haiku. LyX can be redistributed and modified under the terms of the GNU General Public License and is thus free software. | https://en.wikipedia.org/wiki/LyX |
| Lustre | Lustre is a formally defined, declarative, and synchronous dataflow programming language for programming reactive systems. It began as a research project in the early 1980s. A formal presentation of the language can be found in the 1991 Proceedings of the IEEE. In 1993 it progressed to practical, industrial use in a commercial product as the core language of the industrial environment SCADE, developed by Esterel Technologies. It is now used for critical control software in aircraft, helicopters, and nuclear power plants. | https://en.wikipedia.org/wiki/Lustre_(programming_language) |
| Lucidchart | Lucidchart is a web-based proprietary platform that is used to allow users to collaborate on drawing, revising and sharing charts and diagrams.Lucidchart runs on browsers that support HTML5. This means it does not require updates of third party software like flash. In 2010, the firm announced they had integrated into the Google Apps Marketplace.The company raised $1 million in "angel funding" in 2011.On 17 October 2018, the firm announced it had raised an additional $72 million from Meritech Capital and ICONIQ Capital. | https://en.wikipedia.org/wiki/Lucidchart |
| LUCID | Lucid is a dataflow programming language designed to experiment with non-von Neumann programming models. It was designed by Bill Wadge and Ed Ashcroft and described in the 1985 book Lucid, the Dataflow Programming Language. pLucid was the first interpreter for Lucid. | https://en.wikipedia.org/wiki/Lucid_(programming_language) |
| Lua | Lua ( LOO-ə, from Portuguese: lua [ˈlu.(w)ɐ] meaning moon) is a lightweight, multi-paradigm programming language designed primarily for embedded systems and clients. Lua is cross-platform, since the interpreter is written in ANSI C, and has a relatively simple C API. Lua was originally designed in 1993 as a language for extending software applications to meet the increasing demand for customization at the time. It provided the basic facilities of most procedural programming languages, but more complicated or domain-specific features were not included; rather, it included mechanisms for extending the language, allowing programmers to implement such features. As Lua was intended to be a general embeddable extension language, the designers of Lua focused on improving its speed, portability, extensibility, and ease-of-use in development. | https://en.wikipedia.org/wiki/Lua_(programming_language) |
| LotusScript | LotusScript is an object oriented programming language used by Lotus Notes (since version 4.0) and other IBM Lotus Software products. LotusScript is similar to Visual Basic. Developers familiar with one can easily understand the syntax and structure of code in the other. The major differences between the two are in their respective Integrated Development Environments and in the product-specific object classes provided in each language that are included. VB includes a richer set of classes for UI manipulation, whereas LotusScript includes a richer set of application-specific classes for Lotus Notes, Lotus Word Pro and Lotus 1-2-3. In the case of Lotus Notes, there are classes to work with Notes databases, documents (records) in those databases, etc. These classes can also be used as OLE Automation objects outside of the Lotus Notes environment, from Visual Basic. LotusScript also allows the definition of user-defined types and classes, although it is not possible to inherit from the product-specific classes. | https://en.wikipedia.org/wiki/LotusScript |
| Logtalk | Logtalk is an object-oriented logic programming language that extends and leverages the Prolog language with a feature set suitable for programming in the large. It provides support for encapsulation and data hiding, separation of concerns and enhanced code reuse. Logtalk uses standard Prolog syntax with the addition of a few operators and directives. The Logtalk language implementation is distributed under an open source license and can run using a Prolog implementation (compliant with official and de facto standards) as the back-end compiler. | https://en.wikipedia.org/wiki/Logtalk_(programming_language) |
| Logo | Logo is an educational programming language, designed in 1967 by Wally Feurzeig, Seymour Papert and Cynthia Solomon. "Logo" is not an acronym. It was derived from the Greek logos meaning word or "thought" by Feurzeig, to distinguish itself from other programming languages that were primarily numbers, not graphics or logic, oriented. A general-purpose language, Logo is widely known for its use of turtle graphics, in which commands for movement and drawing produced line graphics either on screen or with a small robot called a turtle. The language was conceived to teach concepts of programming related to Lisp and only later to enable what Papert called "body-syntonic reasoning", where students could understand, predict and reason about the turtle's motion by imagining what they would do if they were the turtle. There are substantial differences among the many dialects of Logo, and the situation is confused by the regular appearance of turtle-graphics programs that call themselves Logo. Logo is a multi-paradigm adaptation and dialect of Lisp, a functional programming language. There is no standard Logo, but UCBLogo has the best facilities for handling lists, files, I/O, and recursion in scripts, and can be used to teach all computer science concepts, as UC Berkeley lecturer Brian Harvey did in his Computer Science Logo Style trilogy. Logo is usually an interpreted language, although there have been developed compiled Logo dialects (such as Lhogho and Liogo). Logo is not case-sensitive but retains the case used for formatting. | https://en.wikipedia.org/wiki/Logo_(programming_language) |
| LOGLAN | Loglan is a constructed language originally designed for linguistic research, particularly for investigating the Sapir–Whorf Hypothesis. The language was developed beginning in 1955 by Dr James Cooke Brown with the goal of making a language so different from natural languages that people learning it would think in a different way if the hypothesis were true. In 1960 Scientific American published an article introducing the language. Loglan is the first among, and the main inspiration for, the languages known as logical languages, which also includes Lojban. Brown founded The Loglan Institute (TLI) to develop the language and other applications of it. He always considered the language an incomplete research project, and although he released many papers about its design, he continued to claim legal restrictions on its use. Because of this, a group of his followers later formed the Logical Language Group to create the language Lojban along the same principles, but with the intention to make it freely available and encourage its use as a real language. Supporters of Lojban use the term Loglan as a generic term to refer to both their own language, and Brown's Loglan, referred to as "TLI Loglan" when in need of disambiguation. Although the non-trademarkability of the term Loglan was eventually upheld by the United States Patent and Trademark Office, many supporters and members of The Loglan Institute find this usage offensive, and reserve Loglan for the TLI version of the language. | https://en.wikipedia.org/wiki/Loglan |
| LYaPAS | Logical Language for the Representation of Synthesis Algorithms (LYaPAS, Russian: ЛЯПАС) is a programming language created in the Soviet Union in 1964, by Arkady D.Zakrevskij of the Laboratory of System Programming and Logical Synthesis, of the Academy of Sciences of the Byelorussian SSR, since renamed the National Academy of Sciences of Belarus.LYaPAS is an extension to the programming language APL, and was initially designed especially for non-numeric programming for the Soviet designed and built line of mainframe computers named Ural-1. An interesting feature of LYaPAS is its use of octal numbers. A further refinement of LYaPAS is LYaPAS-M. | https://en.wikipedia.org/wiki/LYaPAS |
| Locomotive BASIC | Locomotive Basic is a proprietary dialect of the BASIC programming language written by Locomotive Software used only on the Amstrad CPC (where it was built-in on ROM). It was the main ancestor of Mallard BASIC, the interpreter for CP/M supplied with the Amstrad PCW. | https://en.wikipedia.org/wiki/Locomotive_BASIC |
| LiveScript | LiveScript is a functional programming language that compiles to JavaScript. It was created by Jeremy Ashkenas—the creator of CoffeeScript—along with Satoshi Muramaki, George Zahariev, and many others. For a brief period in the 1990s, LiveScript was the name of JavaScript. | https://en.wikipedia.org/wiki/LiveScript_(programming_language) |
| RunRev | LiveCode Ltd. (formerly Runtime Revolution and Cross Worlds Computing makes the LiveCode cross-platform development environment (formerly called Revolution) for creating applications that run on iOS, Microsoft Windows, Linux, macOS, Android and Browsers. It is similar to Apple's discontinued HyperCard. | https://en.wikipedia.org/wiki/RunRev |
| Revolution | LiveCode (formerly Revolution and MetaCard) is a cross-platform rapid application development runtime environment inspired by HyperCard. It features the Transcript (formerly MetaTalk) programming language which belongs to the family of xTalk scripting languages like HyperCard's HyperTalk.The environment was introduced in 2001. The "Revolution" development system was based on the MetaCard engine technology which Runtime Revolution later acquired from MetaCard Corporation in 2003. The platform won the Macworld Annual Editor's Choice Award for "Best Development Software" in 2004. "Revolution" was renamed "LiveCode" in the fall of 2010. "LiveCode" is developed and sold by Runtime Revolution Ltd., based in Edinburgh, Scotland. In March, 2015, the company was renamed "LiveCode Ltd.", to unify the company name with the product. In April 2013 a free/open source version 'LiveCode Community Edition 6.0' was published after a successful crowdfunding campaign at Kickstarter. The code base was re-licensed and made available as free and open source software with a version in April 2013. LiveCode runs on iOS, Android, OS X, Windows 95 through Windows 10, Raspberry Pi and several variations of Unix, including Linux, Solaris, and BSD. It can be used for mobile, desktop and server/CGI applications. The iOS (iPhone and iPad) version was released in December 2010. The first version to deploy to the Web was released in 2009. It is the most widely used HyperCard/HyperTalk clone, and the only one that runs on all major operating systems. A developer release of v.8 was announced in New York on March 12, 2015. This major enhancement to the product includes a new, separate development language, known as "LiveCode Builder", which is capable of creating new object classes called "widgets". In earlier versions, the set of object classes was fixed, and could only be enhanced via the use of ordinary procedural languages like C. The new language, which runs in its own IDE, is a departure from the transitional x-talk paradigm in that it permits typing of variables. But the two environments are fully integrated, and apart from the ability to create new objects, development in LiveCode proceeds in the normal way, within the established IDE. A second crowdfunding campaign to Bring HTML5 to LiveCode reached funding goals of nearly $400,000 USD on July 31, 2014. LiveCode developer release 8.0 DP4 (August 31, 2015) was the first to include a standalone deployment option to HTML5. | https://en.wikipedia.org/wiki/Revolution_(programming_language) |
| LiveCode | LiveCode (formerly Revolution and MetaCard) is a cross-platform rapid application development runtime environment inspired by HyperCard. It features the Transcript (formerly MetaTalk) programming language which belongs to the family of xTalk scripting languages like HyperCard's HyperTalk. The environment was introduced in 2001. The "Revolution" development system was based on the MetaCard engine technology which Runtime Revolution later acquired from MetaCard Corporation in 2003. The platform won the Macworld Annual Editor's Choice Award for "Best Development Software" in 2004. "Revolution" was renamed "LiveCode" in the fall of 2010. "LiveCode" is developed and sold by Runtime Revolution Ltd., based in Edinburgh, Scotland. In March, 2015, the company was renamed "LiveCode Ltd.", to unify the company name with the product. In April 2013 a free/open source version 'LiveCode Community Edition 6.0' was published after a successful crowdfunding campaign at Kickstarter. The code base was re-licensed and made available as free and open source software with a version in April 2013. LiveCode runs on iOS, Android, OS X, Windows 95 through Windows 10, Raspberry Pi and several variations of Unix, including Linux, Solaris, and BSD. It can be used for mobile, desktop and server/CGI applications. The iOS (iPhone and iPad) version was released in December 2010. The first version to deploy to the Web was released in 2009. It is the most widely used HyperCard/HyperTalk clone, and the only one that runs on all major operating systems. A developer release of v.8 was announced in New York on March 12, 2015. This major enhancement to the product includes a new, separate development language, known as "LiveCode Builder", which is capable of creating new object classes called "widgets". In earlier versions, the set of object classes was fixed, and could only be enhanced via the use of ordinary procedural languages like C. The new language, which runs in its own IDE, is a departure from the transitional x-talk paradigm in that it permits typing of variables. But the two environments are fully integrated, and apart from the ability to create new objects, development in LiveCode proceeds in the normal way, within the established IDE. A second crowdfunding campaign to Bring HTML5 to LiveCode reached funding goals of nearly $400,000 USD on July 31, 2014. LiveCode developer release 8.0 DP4 (August 31, 2015) was the first to include a standalone deployment option to HTML5. | https://en.wikipedia.org/wiki/LiveCode |
| Little b | Little b is a domain-specific programming language, more specifically, a modeling language, designed to build modular mathematical models of biological systems. It was designed and authored by Aneil Mallavarapu. Little b is being developed in the Virtual Cell Program at Harvard Medical School, headed by mathematician Jeremy Gunawardena. This language is based on Lisp and is meant to allow modular programming to model biological systems. It will allow more flexibility to facilitate rapid change that is required to accurately capture complex biological systems. The language draws on techniques from artificial intelligence and symbolic mathematics, and provides syntactic conveniences derived from object-oriented languages. The language was originally denoted with a lowercase b (distinguishing it from B, the predecessor to the widely used C programming language, but the name was eventually changed to "little b" to avoid confusion and to pay homage to Smalltalk, the first object-oriented programming language. | https://en.wikipedia.org/wiki/Little_b_(programming_language) |
| LC-3 | Little Computer 3, or LC-3, is a type of computer educational programming language, an assembly language, which is a type of low-level programming language. It features a relatively simple instruction set, but can be used to write moderately complex assembly programs, and is a theoretically viable target for a C compiler. The language is less complex than x86 assembly but has many features similar to those in more complex languages. These features make it useful for beginning instruction, so it is most often used to teach fundamentals of programming and computer architecture to computer science and computer engineering students. The LC-3 was developed by Yale N. Patt at the University of Texas at Austin and Sanjay J. Patel at the University of Illinois at Urbana–Champaign. Their specification of the instruction set, the overall architecture of the LC-3, and a hardware implementation can be found in the second edition of their textbook. Courses based on the LC-3 and Patt and Patel's book are offered in many computer engineering and computer science departments. | https://en.wikipedia.org/wiki/LC-3 |
| Lithe | Lithe is an experimental programming language created in 1982 by David Sandberg at the University of Washington which allows the programmer to freely choose their own syntax. Lithe combines the ideas of syntax-directed translation and classes in a novel manner that results in a remarkably simple yet powerful language. | https://en.wikipedia.org/wiki/Lithe_(programming_language) |
| Lite-C | Lite-C is a programming language for multimedia applications and personal computer games, using a syntax subset of the C language with some elements of the C++ language. Its main difference to C is the native implementation of multimedia and computer game related objects like sounds, images, movies, GUI elements, 2D and 3D models, collision detection and rigid body physics. Lite-C executables are compiled instead of interpreted. Lite-C runs on 32-bit and 64-bit Windows XP or Vista operating systems. Lite-C claims to allow very fast programming with a minimum of code, and easy access to non-programmers. For this, the developer provides a 25-lesson workshop that especially deals with the game and multimedia related objects of the language. Lite-C supports the Windows API and the Component Object Model (COM); therefore OpenGL and DirectX programs can directly be written in lite-C. It has integrated the free A8 rendering engine. | https://en.wikipedia.org/wiki/Lite-C |
| LispMe | LispMe is an interpreter for the Scheme programming language developed by Fred Bayer for Palm OS PDAs. It is free software released under the GNU General Public License. It is reasonably close to standard Scheme but is not fully R5RS compliant. Scheme source programs can be stored in Palm OS memopad format while Scheme sessions, are stored in Palm OS PDB database files and can be interrupted and restarted. There is some support for Palm OS user interface primitives. LispMe also provides some database support. LispMe sessions can be given a "starter icon", which appears in the Applications menu, enabling the session to be run as a Palm Pilot application. The product ended development in August 2008, but is fairly complete and quite robust. | https://en.wikipedia.org/wiki/LispMe |
| Lisp Machine Lisp | Lisp Machine Lisp is a programming language, a dialect of the language Lisp. A direct descendant of Maclisp, it was initially developed in the mid to late 1970s as the system programming language for the Massachusetts Institute of Technology (MIT) Lisp machines. Lisp Machine Lisp was also the Lisp dialect with the most influence on the design of Common Lisp. Lisp Machine Lisp branched into three dialects. Symbolics named their variant ZetaLisp. Lisp Machines, Inc. and later Texas Instruments (with the TI Explorer) would share a common code base, but their dialect of Lisp Machine Lisp would differ from the version maintained at the MIT AI Lab by Richard Stallman and others. | https://en.wikipedia.org/wiki/Lisp_Machine_Lisp |
| LFE | Lisp Flavored Erlang (LFE) is a functional, concurrent, general-purpose programming language and Lisp dialect built on top of Core Erlang and the Erlang Virtual Machine (BEAM). LFE builds on top of Erlang in order to provide a Lisp syntax for writing distributed, fault-tolerant, soft real-time, non-stop applications. LFE also extends Erlang to support meta-programming with Lisp macros and an improved developer experience with a feature-rich REPL. LFE is actively supported on all recent releases of Erlang; the oldest version of Erlang supported is R14. | https://en.wikipedia.org/wiki/LFE_(programming_language) |
| Lisp | Lisp (historically, LISP) is a family of computer programming languages with a long history and a distinctive, fully parenthesized prefix notation. Originally specified in 1958, Lisp is the second-oldest high-level programming language in widespread use today. Only Fortran is older, by one year. Lisp has changed since its early days, and many dialects have existed over its history. Today, the best known general-purpose Lisp dialects are Common Lisp and Scheme. Lisp was originally created as a practical mathematical notation for computer programs, influenced by the notation of Alonzo Church's lambda calculus. It quickly became the favored programming language for artificial intelligence (AI) research. As one of the earliest programming languages, Lisp pioneered many ideas in computer science, including tree data structures, automatic storage management, dynamic typing, conditionals, higher-order functions, recursion, the self-hosting compiler, and the read–eval–print loop. The name LISP derives from "LISt Processor". Linked lists are one of Lisp's major data structures, and Lisp source code is made of lists. Thus, Lisp programs can manipulate source code as a data structure, giving rise to the macro systems that allow programmers to create new syntax or new domain-specific languages embedded in Lisp. The interchangeability of code and data gives Lisp its instantly recognizable syntax. All program code is written as s-expressions, or parenthesized lists. A function call or syntactic form is written as a list with the function or operator's name first, and the arguments following; for instance, a function f that takes three arguments would be called as (f arg1 arg2 arg3). | https://en.wikipedia.org/wiki/Lisp_(programming_language) |
| Linux | Linux ( ( listen) LIN-əks) is a family of free and open-source software operating systems built around the Linux kernel. Typically, Linux is packaged in a form known as a Linux distribution (or distro for short) for both desktop and server use. The defining component of a Linux distribution is the Linux kernel, an operating system kernel first released on September 17, 1991, by Linus Torvalds. Many Linux distributions use the word "Linux" in their name. The Free Software Foundation uses the name GNU/Linux to refer to the operating system family, as well as specific distributions, to emphasize that most Linux distributions are not just the Linux kernel, and that they have in common not only the kernel, but also numerous utilities and libraries, a large proportion of which are from the GNU project. This has led to some controversy.Linux was originally developed for personal computers based on the Intel x86 architecture, but has since been ported to more platforms than any other operating system. Because of the dominance of the Linux kernel-based Android OS on smartphones, Linux has the largest installed base of all general-purpose operating systems. Linux is also the leading operating system on servers and other big iron systems such as mainframe computers, and the only OS used on TOP500 supercomputers (since November 2017, having before gradually eliminated all competitors). It is used by around 2.3% of desktop computers. The Chromebook, which runs the Linux kernel-based Chrome OS, dominates the US K–12 education market and represents nearly 20% of the sub-$300 notebook sales in the US. Linux also runs on embedded systems, i.e. devices whose operating system is typically built into the firmware and is highly tailored to the system. This includes TiVo and similar DVR devices, network routers, facility automation controls, televisions, video game consoles and smartwatches. Many smartphones and tablet computers run Android and other Linux derivatives.The development of Linux is one of the most prominent examples of free and open-source software collaboration. The underlying source code may be used, modified and distributed—commercially or non-commercially—by anyone under the terms of its respective licenses, such as the GNU General Public License. Some of the most popular and mainstream Linux distributions are Arch Linux, CentOS, Debian, Raspbian, Fedora, Gentoo Linux, Linux Mint, Mageia, openSUSE and Ubuntu, together with commercial distributions such as Red Hat Enterprise Linux and SUSE Linux Enterprise Server. Distributions include the Linux kernel, supporting utilities and libraries, many of which are provided by the GNU Project, and usually a large amount of application software to fulfil the distribution's intended use. Desktop Linux distributions include a windowing system, such as X11, Mir or a Wayland implementation, and an accompanying desktop environment such as GNOME or KDE Plasma; some distributions may also include a less resource-intensive desktop, such as LXDE or Xfce. Distributions intended to run on servers may omit all graphical environments from the standard install, and instead include other software to set up and operate a solution stack such as LAMP. Because Linux is freely redistributable, anyone may create a distribution for any intended use. | https://en.wikipedia.org/wiki/Linux |
| Linotte | Linotte is an interpreted 4th generation programming language. Linotte's syntax is in French. The language's goal is to allow French-speaking children and other francophones with little computer science experience to easily learn programming, with the slogan (in French) "you know how to read a book, so you can write a computer program". | https://en.wikipedia.org/wiki/Linotte |
| Lingo | Lingo is a verbose object-oriented (OO) scripting language developed by John H. Thompson for use in Adobe Director (formerly Macromedia Director). Lingo is used to develop desktop application software, interactive kiosks, CD-ROMs and Adobe Shockwave content. Lingo is the primary programming language on the Adobe Shockwave platform, which dominated the interactive multimedia product market during the 1990s. Various graphic adventure games were developed with Lingo during the 1990s, including The Journeyman Project, Total Distortion, Mia's Language Adventure, Mia's Science Adventure, and the Didi & Ditto series. Hundreds of free online video games were developed using Lingo, and published on websites such as Miniclip and Shockwave.com. Lingo can be used to build user interfaces, to manipulate raster graphics, vector graphics and 3D computer graphics, and other data processing tasks. Lingo supports specialized syntax for image processing and 3D object manipulation. 3D meshes can also be created on the fly using Lingo. | https://en.wikipedia.org/wiki/Lingo_(programming_language) |
| Limbo | Limbo is a programming language for writing distributed systems and is the language used to write applications for the Inferno operating system. It was designed at Bell Labs by Sean Dorward, Phil Winterbottom, and Rob Pike. The Limbo compiler generates architecture-independent object code which is then interpreted by the Dis virtual machine or compiled just before runtime to improve performance. Therefore all Limbo applications are completely portable across all Inferno platforms. Limbo's approach to concurrency was inspired by Hoare's communicating sequential processes (CSP), as implemented and amended in Pike's earlier Newsqueak language and Winterbottom's Alef. | https://en.wikipedia.org/wiki/Limbo_(programming_language) |
| LilyPond | LilyPond is a computer program and file format for music engraving. One of LilyPond's major goals is to produce scores that are engraved with traditional layout rules, reflecting the era when scores were engraved by hand. LilyPond is cross-platform, and is available for several common operating systems; released under the terms of the GNU General Public License, LilyPond is free software. | https://en.wikipedia.org/wiki/LilyPond |
| Liberty BASIC | Liberty BASIC (LB) is a commercial computer programming language and integrated development environment (IDE). It has an interpreter, developed in Smalltalk, which recognizes its own dialect of the BASIC programming language. It runs on 16- and 32-bit Windows and OS/2. | https://en.wikipedia.org/wiki/Liberty_BASIC |
| Lex | Lex is a computer program that generates lexical analyzers ("scanners" or "lexers"). Lex is commonly used with the yacc parser generator. Lex, originally written by Mike Lesk and Eric Schmidt and described in 1975, is the standard lexical analyzer generator on many Unix systems, and an equivalent tool is specified as part of the POSIX standard. Lex reads an input stream specifying the lexical analyzer and outputs source code implementing the lexer in the C programming language. | https://en.wikipedia.org/wiki/Lex_(software) |
| Less | Less (sometimes stylized as LESS) is a dynamic style sheet language that can be compiled into Cascading Style Sheets (CSS) and run on the client side or server side. Designed by Alexis Sellier, Less is influenced by Sass and has influenced the newer "SCSS" syntax of Sass, which adapted its CSS-like block formatting syntax. Less is open source. Its first version was written in Ruby; however, in the later versions, use of Ruby has been deprecated and replaced by JavaScript. The indented syntax of Less is a nested metalanguage, as valid CSS is valid Less code with the same semantics. Less provides the following mechanisms: variables, nesting, mixins, operators and functions; the main difference between Less and other CSS precompilers being that Less allows real-time compilation via less.js by the browser. | https://en.wikipedia.org/wiki/Less_(stylesheet_language) |
| Leda | Leda is a multiparadigm programming language whose goal is to successfully mix imperative, object-oriented, functional, and logic-based programming features into one language. It is described in the book Multiparadigm Programming in Leda written by the principal designer Dr. Timothy Budd at Oregon State University. | https://en.wikipedia.org/wiki/Leda_(programming_language) |
| Le-Lisp | Le Lisp (also Le_Lisp and Le-Lisp) is a programming language, a dialect of the language Lisp.It was developed at the French Institute for Research in Computer Science and Automation (INRIA), to be an implementation language for a very large scale integration (VLSI) workstation being designed under the direction of Jean Vuillemin. Le Lisp also had to run on various incompatible platforms (mostly running Unix operating systems) that were used by the project. The main goals for the language were to be a powerful post-Maclisp version of Lisp that would be portable, compatible, extensible, and efficient.Jérôme Chailloux led the Le Lisp team, working with Emmanuel St. James, Matthieu Devin, and Jean-Marie Hullot in 1980. The dialect is historically noteworthy as one of the first Lisp implementations to be available on both the Apple II and the IBM PC. | https://en.wikipedia.org/wiki/Le_Lisp |
| Lazy ML | Lazy ML (LML) is a functional programming language developed in the early 1980s by Lennart Augustsson and Thomas Johnsson at Chalmers University of Technology, prior to Miranda and Haskell. LML is a strongly typed, statically scoped implementation of ML, with lazy evaluation. The key innovation of LML was to demonstrate how to compile a lazy functional language. Until then, lazy languages had been implemented via interpreted graph reduction. LML compiled to G-machine code. LML is also notable as the language in which HBC, the Haskell B Compiler, was implemented. | https://en.wikipedia.org/wiki/Lazy_ML |
| Lava | Lava is an experimental, visual object-oriented, interpreter-based programming language with an associated programming environment (Lava Programming Environment or LavaPE) that uses structure editors instead of text editors. Only comments, constants, and new identifiers may be entered as text. Declarations are represented in LavaPE as tree structures whose subtrees may be collapsed or expanded. The properties of the declared Lava entities can be edited through pop-up dialogs. Although executable code has a traditional text representation in LavaPE, it can be edited only as complete syntactic units, rather than character by character. If you insert a new syntactic construct, it will typically contain "placeholders" (syntactic variables) that can then be replaced by concrete constructs; the latter may in turn contain syntactic variables, etc. LavaPE provides a tool button for every type of syntactic construct, and a button is enabled only if it is syntactically correct to insert the associated construct at the selected place. Further characteristic properties of Lava and LavaPE include the following: It provides strict syntactic separation of interface (public) and implementation (private) sections of a Lava class. It distinguishes variable "state objects" from constant "value objects"; the latter cannot be modified any longer after creation/initialization. It supports "virtual types": type parameters of classes and packages (families of related classes). As a consequence, undermining of strong type checks by "type casts" is no longer required. It uses recursion and logical quantifiers instead of traditional loop constructs. It uses single assignment; i.e., a value can be assigned to a variable only once within the same branch of a function. It supports refactoring extensively via the LavaPE structure editors. It distinguishes between constituents (sub-objects) and object acquaintances (pointers to independent objects). Copying and deletion of complex objects is largely facilitated in this way. Since release 0.9.0, LavaPE completely prevents inadvertent access to uninitialized variables and null objects already at programming time by complete static initialization checks.Lava is open source software using the GPL license (see also Lava at the Free Software Foundation and at KDE-Apps.org). It currently runs on Microsoft Windows, Linux and Mac OS X platforms. | https://en.wikipedia.org/wiki/Lava_(programming_language) |
| Lasso | Lasso is an application server and server management interface used to develop internet applications and is a general-purpose, high-level programming language. Originally a web datasource connection tool, for Filemaker and later included in Apple Computer's FileMaker 4.0 and Claris Homepage as CDML, it has since evolved into a complex language used to develop and serve large-scale internet applications and web pages. Lasso includes a simple template system allowing code to control generation of HTML and other content types. Lasso is object-oriented and every value is an object. It also supports procedural programming through unbound methods. The language uses traits and multiple dispatch extensively. Lasso has a dynamic type system, where objects can be loaded and augmented at runtime, automatic memory management, a comprehensive standard library, and three compiling methodologies: dynamic (comparable to PHP-Python), just-in-time compilation (comparable to Java or .NET Framework), and pre-compiled (comparable to C). Lasso also supports Query Expressions, allowing elements within arrays and other types of sequences to be iterated, filtered, and manipulated using a natural language syntax similar to SQL. Lasso includes full Unicode character support in the standard string object, allowing it to serve and support multi-byte characters such as Japanese and Swedish, and supports transparent UTF-8 conversion when writing string data to the network or file system. Lasso is often used as a scripting language, and also used in a wide range of non-scripting contexts. Lasso code can be packaged into standalone executable programs called "LassoApps", in which folder structures are compiled into single files. The Lasso Server application server runs as a system service and receives requests from the web server through FastCGI. It then hands the request off to the appropriate Lasso Instance, which formulates the response. Multiple individual instances are supported, allowing one server to handle multiple sites, each as separate processes. The server uses a high performance IO-based green threading system designed for multi-core systems. Lasso can be compared to the server-side scripting languages PHP and Python, ColdFusion, Ruby, etc. Free for development, Lasso allows partial access to its source code, allowing developers to add or change major components of the language (for example, Ke Carlton's DS implementation of the Lasso Inline). Licensing comes in both SAS and stand-alone versions. | https://en.wikipedia.org/wiki/Lasso_(programming_language) |
| Larceny Scheme implementation | Larceny is an implementation of the Scheme programming language built around the Twobit optimizing compiler. Larceny offers several back-ends able to target native x86 and ARMv7 code. Petit Larceny is also available and emits C source code, which can then be further compiled to native code with an ordinary C compiler.Older versions (<0.98) included support for the SPARC architecture in Larceny, and for Microsoft's Common Language Runtime via Common Larceny.Larceny supports all major Scheme standards (R5RS, IEEE/ANSI, R6RS, and R7RS. The Larceny software is open source and available online. | https://en.wikipedia.org/wiki/Larceny_(Scheme_implementation) |
| Laravel | Laravel is a free, open-source PHP web framework, created by Taylor Otwell and intended for the development of web applications following the model–view–controller (MVC) architectural pattern and based on Symfony. Some of the features of Laravel are a modular packaging system with a dedicated dependency manager, different ways for accessing relational databases, utilities that aid in application deployment and maintenance, and its orientation toward syntactic sugar.The source code of Laravel is hosted on GitHub and licensed under the terms of MIT License. | https://en.wikipedia.org/wiki/Laravel |
| LINQ | Language Integrated Query (LINQ, pronounced "link") is a Microsoft .NET Framework component that adds native data querying capabilities to .NET languages, although ports exist for PHP (PHPLinq), JavaScript (linq.js), TypeScript (linq.ts), and ActionScript (ActionLinq) - but none of these ports are strictly equivalent to LINQ in C# for example (where it is a part of the language, not an external library, and where it often addresses a wider range of needs). LINQ extends the language by the addition of query expressions, which are akin to SQL statements, and can be used to conveniently extract and process data from arrays, enumerable classes, XML documents, relational databases, and third-party data sources. Other uses, which utilize query expressions as a general framework for readably composing arbitrary computations, include the construction of event handlers or monadic parsers. LINQ also defines a set of method names (called standard query operators, or standard sequence operators), along with translation rules used by the compiler to translate fluent-style query expressions into expressions using these method names, lambda expressions and anonymous types. Many of the concepts that LINQ has introduced were originally tested in Microsoft's Cω research project. LINQ was released as a major part of .NET Framework 3.5 on November 19, 2007. | https://en.wikipedia.org/wiki/Language_Integrated_Query |
| Lagoona | Lagoona is an experimental programming language developed by Michael Franz, a former student of Niklaus Wirth. It explores component-oriented programming with the use of stand-alone messages and message sets, message forwarding, and by de-emphasizing classes. | https://en.wikipedia.org/wiki/Lagoona_(programming_language) |
| Ladder Logic | Ladder logic was originally a written method to document the design and construction of relay racks as used in manufacturing and process control. Each device in the relay rack would be represented by a symbol on the ladder diagram with connections between those devices shown. In addition, other items external to the relay rack such as pumps, heaters, and so forth would also be shown on the ladder diagram. See relay logic. Ladder logic has evolved into a programming language that represents a program by a graphical diagram based on the circuit diagrams of relay logic hardware. Ladder logic is used to develop software for programmable logic controllers (PLCs) used in industrial control applications. The name is based on the observation that programs in this language resemble ladders, with two vertical rails and a series of horizontal rungs between them. While ladder diagrams were once the only available notation for recording programmable controller programs, today other forms are standardized in IEC 61131-3 (For example, as an alternative to the graphical ladder logic form, there is also a more assembly language like format called Instruction list within the IEC 61131-3 standard.). | https://en.wikipedia.org/wiki/Ladder_logic |
| LabVIEW G | Laboratory Virtual Instrument Engineering Workbench (LabVIEW) is a system-design platform and development environment for a visual programming language from National Instruments. The graphical language is named "G"; not to be confused with G-code. Originally released for the Apple Macintosh in 1986, LabVIEW is commonly used for data acquisition, instrument control, and industrial automation on a variety of operating systems (OSs), including Microsoft Windows, various versions of Unix, Linux, and macOS. The latest versions of LabVIEW are LabVIEW 2017 and LabVIEW NXG 1.0, released in May 2017. | https://en.wikipedia.org/wiki/LabVIEW |
| LaTeX | LaTeX (IPA: , LAH-tekh, also pronounced as , LAY-tekh, a shortening of Lamport TeX) is a document preparation system. When writing, the writer uses plain text as opposed to the formatted text found in WYSIWYG word processors like Microsoft Word, LibreOffice Writer and Apple Pages. The writer uses markup tagging conventions to define the general structure of a document (such as article, book, and letter), to stylise text throughout a document (such as bold and italics), and to add citations and cross-references. A TeX distribution such as TeX Live or MikTeX is used to produce an output file (such as PDF or DVI) suitable for printing or digital distribution. Within the typesetting system, its name is stylised as LaTeX. LaTeX is widely used in academia for the communication and publication of scientific documents in many fields, including mathematics, statistics, computer science, engineering, chemistry, physics, economics, linguistics, quantitative psychology, philosophy, and political science. It also has a prominent role in the preparation and publication of books and articles that contain complex multilingual materials, such as Tamil, Sanskrit and Greek. LaTeX uses the TeX typesetting program for formatting its output, and is itself written in the TeX macro language. LaTeX can be used as a standalone document preparation system or as an intermediate format. In the latter role, for example, it is sometimes used as part of a pipeline for translating DocBook and other XML-based formats to PDF. The typesetting system offers programmable desktop publishing features and extensive facilities for automating most aspects of typesetting and desktop publishing, including numbering and cross-referencing of tables and figures, chapter and section headings, the inclusion of graphics, page layout, indexing and bibliographies. Like TeX, LaTeX started as a writing tool for mathematicians and computer scientists, but from early in its development it has also been taken up by scholars who needed to write documents that include complex math expressions or non-Latin scripts, such as Arabic, Sanskrit and Chinese. LaTeX is intended to provide a high-level language that accesses the power of TeX in an easier way for writers. In short, TeX handles the layout side, while LaTeX handles the content side for document processing. LaTeX comprises a collection of TeX macros and a program to process LaTeX documents. Because the plain TeX formatting commands are elementary, it provides authors with ready-made commands for formatting and layout requirements such as chapter headings, footnotes, cross-references and bibliographies. LaTeX was originally written in the early 1980s by Leslie Lamport at SRI International. The current version is LaTeX2e (stylised as LaTeX2ε). LaTeX is free software and is distributed under the LaTeX Project Public License (LPPL). | https://en.wikipedia.org/wiki/LaTeX |
| Langage Sans Espoir | LSE (French: Langage symbolique d'enseignement) is a programming language developed at Supélec in the late 1970s/early 1980s. It is similar to BASIC, except with French-language instead of English-language keywords. It was derived from an earlier language called LSD, also developed at Supélec. It is most commonly said to be an acronym for Langage Symbolique d'Enseignement (Symbolic Teaching Language), but other expansions are also known (e.g. Langage de Sup-Élec, or the more cynical Langage Sans Espoir (hopeless language)). It originally flourished due to support from the French Ministry of National Education, but declined as the ministry lost interest. It went through a number of revisions; earlier versions of LSE lacked full support for structured programming, which later version added, along with exception handling. | https://en.wikipedia.org/wiki/LSE_(programming_language) |
| LPC | LPC (short for Lars Pensjö C) is an object-oriented programming language derived from C and developed originally by Lars Pensjö to facilitate MUD building on LPMuds. Though designed for game development, its flexibility has led to it being used for a variety of purposes, and to its evolution into the language Pike. LPC syntax places it in the family of C-like languages, with C and C++ its strongest influences. | https://en.wikipedia.org/wiki/LPC_(programming_language) |
| LOLCODE | LOLCODE is an esoteric programming language inspired by lolspeak, the language expressed in examples of the lolcat Internet meme. The language was created in 2007 by Adam Lindsay, researcher at the Computing Department of Lancaster University. The language is not clearly defined in terms of operator priorities and correct syntax, but several functioning interpreters and compilers exist. One interpretation of the language has been proven Turing-complete. | https://en.wikipedia.org/wiki/LOLCODE |
| Langage Implementation Systeme | LIS (Language d'Implementation de Systèmes) was a system implementation programming language designed by Jean Ichbiah, who later designed Ada. LIS was used to implement the compiler for the Ada-0 subset of Ada at Karlsruhe on the BS2000 Siemens operating system. Later on the Karlsruhe Ada compilation system got rewritten in Ada-0 itself, which was easy, because LIS and Ada-0 are very close. | https://en.wikipedia.org/wiki/LIS_(programming_language) |
| LINC 4GL | LINC ("Logic and Information Network Compiler") is a fourth-generation programming language, used mostly on Unisys computer systems. | https://en.wikipedia.org/wiki/LINC_4GL |
| LIMDEP | LIMDEP is an econometric and statistical software package with a variety of estimation tools. In addition to the core econometric tools for analysis of cross sections and time series, LIMDEP supports methods for panel data analysis, frontier and efficiency estimation and discrete choice modeling. The package also provides a programming language to allow the user to specify, estimate and analyze models that are not contained in the built in menus of model forms. | https://en.wikipedia.org/wiki/LIMDEP |
| Little Implementation Language | LIL, the Little Implementation Language, was a system programming language during the early days of Unix history on PDP-11 machines. It was written by P. J. Plauger of Bell Labs. LIL attempted to fill the gap between assemblers and machine-independent system implementation languages (such as the C programming language), by basically adding structured programming to the PDP-11 assembly language. LIL resembled PL360 with C-like flow control syntax. The LIL compiler "lc" was part of Fifth Edition Unix (1974), but was dropped by Sixth Edition Unix (1975). Plauger left Bell Labs in the same year. Plauger explains why LIL was abandoned in Bell Labs in favor of C: [1] ... LIL is, however, a failure. Its stiffest competition at Bell Labs is the language C, which is higher level, and machine independent. Every time it looked like C was too expensive to use for a particular project, LIL was considered. But almost every time, it proved easier (and more rewarding) to improve C, or its runtime support, or the hardware, than to invest time in yet another language. ... A machine independent language is always superior -- even for writing machine dependent code (it's easier to find trained programmers) -- so long as the overhead can be endured. It is clear now that writing straightforward code and then measuring it is the formula for the best end product. At worst there will be 5-15 per cent overhead, which is seldom critical. Once system writers become mature enough to recognize this basic truth, they gravitate naturally toward machine independent SILs. ... it looks like the little implementation language is an idea whose time as come -- and gone. | https://en.wikipedia.org/wiki/Little_Implementation_Language |
| LEXX | LEXX is a text editor which was possibly the first to use live parsing and colour syntax highlighting. It was written by Mike Cowlishaw of IBM around 1985. The name was chosen because he wrote it as a tool for lexicographers, during an assignment for Oxford University Press's second edition of the Oxford English Dictionary. The program ran (and still, in 2018, runs) on mainframes under VM/CMS. LEXX's design was based on several other editors written by the same author (such as STET) augmented by the ability to dynamically parse text and display colour on the new colour terminals that had recently became available (PC-based, and stand-alone such as the IBM 3279). LEXX uses dynamically-loaded parsers which assign classes of elements (tokens formed from character strings) to fonts and colors. It allows indention to be used to format and show the structure of the file being edited, and other formatting options allow (for example) the hiding of selected classes of text, such as tags. A collection of screenshots is available.LPEX ('Live Parsing Editor") is a reimplemented derivative of the LEXX concept, originally produced for OS/2 and AIX. It now also runs on Windows, Linux, and the Java JVM. | https://en.wikipedia.org/wiki/LEXX_(text_editor) |
| NXT-G | LEGO Mindstorms NXT is a programmable robotics kit released by Lego in late July 2006. It replaced the first-generation Lego Mindstorms kit, which was called the Robotics Invention System. The base kit ships in two versions: the Retail Version (set #8527) and the Education Base Set (set #9797). It comes with the NXT-G programming software, or optionally LabVIEW for Lego Mindstorms. A variety of unofficial languages exist, such as NXC, NBC, leJOS NXJ, and RobotC. The second generation of the set, the Lego Mindstorms NXT 2.0, was released on August 1, 2009, featuring a color sensor and other upgraded capabilities. The third generation, the EV3, was released in September 2013. | https://en.wikipedia.org/wiki/NXT-G |
| LEAP | LEAP is an extension to the ALGOL 60 programming language which provides an associative memory of triples. The three items in a triple denote the association that an Attribute of an Object has a specific Value. LEAP was created by Jerome Feldman (University of California Berkeley) and Paul Rovner (MIT Lincoln Lab) in 1967. LEAP was also implemented in SAIL. | https://en.wikipedia.org/wiki/LEAP_(programming_language) |
| Kotlin | Kotlin is a statically-typed programming language that runs on the Java virtual machine and also can be compiled to JavaScript source code or use the LLVM compiler infrastructure. Its primary development is from a team of JetBrains programmers based in Saint Petersburg, Russia. While the syntax is not compatible with Java, Kotlin is designed to interoperate with Java code and is reliant on Java code from the existing Java Class Library, such as the collections framework. As of Android Studio 3.0 (Beta version) Kotlin is a fully supported programming language on Android and lets the user choose between targeting Java 6- or Java 8-compatible bytecode. | https://en.wikipedia.org/wiki/Kotlin_(programming_language) |
| Korn shell | KornShell (ksh) is a Unix shell which was developed by David Korn at Bell Labs in the early 1980s and announced at USENIX on July 14, 1983. The initial development was based on Bourne shell source code. Other early contributors were Bell Labs developers Mike Veach and Pat Sullivan, who wrote the Emacs and vi-style line editing modes' code, respectively. KornShell is backward-compatible with the Bourne shell and includes many features of the C shell, inspired by the requests of Bell Labs users. | https://en.wikipedia.org/wiki/KornShell |
| KonsolScript | KonsolScript is a cross-platform scripting language used mostly for games. It is available for Windows and Linux Operating Systems. KonsolScript was developed during 2005 as the scripting language which is intentionally for the purpose writing games with KAGE (Alternative Game Engine). However, its interpreter, Quixie, can also be used as common gateway interface for serving web pages. KonsolScript's language design is greatly inspired by C programming language and VergeC, although its drawing API is inspired by ActionScript. Together with KAGE, KonsolScript was distributed as freeware until it was released as free software in SourceForge on April 2006. KonsolScript is licensed under GNU General Public License. | https://en.wikipedia.org/wiki/KonsolScript |
| Kodu Game Lab | Kodu, originally named Boku, is a programming integrated development environment (IDE) by Microsoft's FUSE Labs. It runs on Xbox 360 and Microsoft Windows XP, Windows Vista, Windows 7, Windows 8 and Windows 10. It was released on the Xbox Live Marketplace on June 30, 2009. A Windows version is available to the general public for download from Microsoft's FUSE web portal. | https://en.wikipedia.org/wiki/Kodu_Game_Lab |
| Knowledge Interchange Format | Knowledge Interchange Format (KIF) is a computer language designed to enable systems to share and re-use information from knowledge-based systems. KIF is similar to frame languages such as KL-One and LOOM but unlike such language its primary role is not intended as a framework for the expression or use of knowledge but rather for the interchange of knowledge between systems. The designers of KIF likened it to PostScript. PostScript was not designed primarily as a language to store and manipulate documents but rather as an interchange format for systems and devices to share documents. In the same way KIF is meant to facilitate sharing of knowledge across different systems that use different languages, formalisms, platforms, etc. KIF has a declarative semantics. It is meant to describe facts about the world rather than processes or procedures. Knowledge can be described as objects, functions, relations, and rules. It is a formal language, i.e., it can express arbitrary statements in first order logic and can support reasoners that can prove the consistency of a set of KIF statements. KIF also supports non-monotonic reasoning. KIF was created by Michael Genesereth, Richard Fikes and others participating in the DARPA knowledge Sharing Effort.Although the original KIF group intended to submit to a formal standards body, that did not occur. A later version called Common Logic has since been developed for submission to ISO and has been approved and published. A variant called SUO-KIF is the language in which the Suggested Upper Merged Ontology is written. | https://en.wikipedia.org/wiki/Knowledge_Interchange_Format |
| Kid templating language | Kid is a simple template engine for XML-based vocabularies written in Python. Kid claims to have many of the best features of XSLT, TAL, and PHP, but "with much of the limitations and complexity stamped out". Kid initially acted as the View component of the TurboGears framework in the framework's version 1.x implementation; however, the TurboGears project team has since replaced it with Genshi, citing perceived performance advantages.Kid is used by the Fedora Project in the repoview utility which creates a set of static HTML pages within a YUM repository. | https://en.wikipedia.org/wiki/Kid_(templating_language) |
| KiXtart | KiXtart is a closed source free-format scripting language for Windows. It is described as a logon script processor and enhanced batch scripting language by the official website. Its name is a portmanteau of "kick start". | https://en.wikipedia.org/wiki/KiXtart |
| KiCad Legacy Layout | KiCad (pronounced "Key-CAD") is a free software suite for electronic design automation (EDA). It facilitates the design of schematics for electronic circuits and their conversion to PCB designs. KiCad was originally developed by Jean-Pierre Charras. It features an integrated environment for schematic capture and PCB layout design. Tools exist within the package to create a bill of materials, artwork, Gerber files, and 3D views of the PCB and its components. | https://en.wikipedia.org/wiki/KiCad |
| Agilent VEE | Keysight VEE is a graphical dataflow programming software development environment from Keysight Technologies for automated test, measurement, data analysis and reporting. VEE originally stood for Visual Engineering Environment and developed by HP designated as HP VEE; it has since been officially renamed to Keysight VEE. Keysight VEE has been widely used in various industries, serving the entire stage of a product lifecycle, from design, validation to manufacturing. It is optimized in instrument control and automation with test and measurement devices such as data acquisition instruments like digital voltmeters and oscilloscopes, and source devices like signal generators and programmable power supplies. | https://en.wikipedia.org/wiki/Keysight_VEE |
| KML | Keyhole Markup Language (KML) is an XML notation for expressing geographic annotation and visualization within Internet-based, two-dimensional maps and three-dimensional Earth browsers. KML was developed for use with Google Earth, which was originally named Keyhole Earth Viewer. It was created by Keyhole, Inc, which was acquired by Google in 2004. KML became an international standard of the Open Geospatial Consortium in 2008. Google Earth was the first program able to view and graphically edit KML files. Other projects such as Marble have also started to develop KML support. | https://en.wikipedia.org/wiki/Keyhole_Markup_Language |
| KL0 | Kernel Language 0 (KL0) is a sequential logic programming language based on Prolog, used in the ICOT Fifth generation computer project. | https://en.wikipedia.org/wiki/KL0 |
| Kermeta | Kermeta is a modeling and programming language for metamodel engineering. | https://en.wikipedia.org/wiki/Kermeta |
| Keras | Keras is an open source neural network library written in Python. It is capable of running on top of TensorFlow, Microsoft Cognitive Toolkit, or Theano. Designed to enable fast experimentation with deep neural networks, it focuses on being user-friendly, modular, and extensible. It was developed as part of the research effort of project ONEIROS (Open-ended Neuro-Electronic Intelligent Robot Operating System), and its primary author and maintainer is François Chollet, a Google engineer. In 2017, Google's TensorFlow team decided to support Keras in TensorFlow's core library. Chollet explained that Keras was conceived to be an interface rather than a standalone machine-learning framework. It offers a higher-level, more intuitive set of abstractions that make it easy to develop deep learning models regardless of the computational backend used. Microsoft added a CNTK backend to Keras as well, available as of CNTK v2.0. | https://en.wikipedia.org/wiki/Keras |
| Kawa | Kawa is a language framework written in the programming language Java that implements the programming language Scheme, a dialect of Lisp, and can be used to implement other languages to run on the Java virtual machine (JVM). It is a part of the GNU Project. The name Kawa comes from the Polish word for coffee; a play on words, since Java is another familiar name for coffee. | https://en.wikipedia.org/wiki/Kawa_%28Scheme_implementation%29 |
| Karel | Karel is an educational programming language for beginners, created by Richard E. Pattis in his book Karel The Robot: A Gentle Introduction to the Art of Programming. Pattis used the language in his courses at Stanford University, California. The language is named after Karel Čapek, a Czech writer who introduced the word robot. | https://en.wikipedia.org/wiki/Karel_(programming_language) |
| Kaggle | Kaggle is an online community of data scientists and machine learners, owned by Google LLC. Kaggle allows users to find and publish data sets, explore and build models in a web-based data-science environment, work with other data scientists and machine learning engineers, and enter competitions to solve data science challenges. Kaggle got its start by offering machine learning competitions and now also offers a public data platform, a cloud-based workbench for data science, and short form AI education. On 8 March 2017, Google announced that they were acquiring Kaggle. | https://en.wikipedia.org/wiki/Kaggle |
| KRL | KRL is a knowledge representation language, developed by Daniel G. Bobrow and Terry Winograd while at Xerox PARC and Stanford University, respectively. It is a frame-based language. KRL was an attempt to produce a language which was nice to read and write for the engineers who had to write programs in it, processed like human memory, so you could have realistic AI programs, had an underlying semantics which was firmly grounded like logic languages, all in one, all in one language. And I think it - again, in hindsight - it just bogged down under the weight of trying to satisfy all those things at once. | https://en.wikipedia.org/wiki/KRL_(programming_language) |
| KRC | KRC (Kent Recursive Calculator) is a lazy functional language developed by David Turner from November 1979 to October 1981 based on SASL, with pattern matching, guards and ZF expressions (now more usually called list comprehensions). Two implementations of KRC were written: David Turner's original one in BCPL running on EMAS, and Simon J. Croft's later one in C under Unix, and KRC was the main language used for teaching functional programming at the University of Kent at Canterbury (UK) from 1982 to 1985. The direct successor to KRC is Miranda, which includes a polymorphic type discipline based on that of Milner's ML. | https://en.wikipedia.org/wiki/Kent_Recursive_Calculator |
| K | K is a proprietary array processing language developed by Arthur Whitney and commercialized by Kx Systems. Since then, an open-source implementation known as Kona has also been developed. The language serves as the foundation for kdb+, an in-memory, column-based database, and other related financial products. The language, originally developed in 1993, is a variant of APL and contains elements of Scheme. Advocates of the language emphasize its speed, facility in handling arrays, and expressive syntax. | https://en.wikipedia.org/wiki/K_(programming_language) |
| Jython | Jython is an implementation of the Python programming language designed to run on the Java platform. It is the successor of JPython. | https://en.wikipedia.org/wiki/Jython |
| Julia | Julia is a high-level dynamic programming language designed to address the needs of high-performance numerical analysis and computational science, without the typical need of separate compilation to be fast, while also being effective for general-purpose programming, web use or as a specification language. Distinctive aspects of Julia's design include a type system with parametric polymorphism and types in a fully dynamic programming language and multiple dispatch as its core programming paradigm. It allows concurrent, parallel and distributed computing, and direct calling of C and Fortran libraries without glue code. Julia is garbage-collected, uses eager evaluation and includes efficient libraries for floating-point calculations, linear algebra, random number generation, fast Fourier transforms and regular expression matching. | https://en.wikipedia.org/wiki/Julia_(programming_language) |
| Judoscript | Judoscript is one of several general purpose programming languages designed primarily for scripting on the Java platform. Its originator and primary developer is software engineer James Jianbo Huang. | https://en.wikipedia.org/wiki/Judoscript |
| Joule | Joule is a concurrent dataflow programming language, designed for building distributed applications. It is so concurrent that the order of statements within a block is irrelevant to the operation of the block. Statements are executed whenever possible, based on their inputs. Everything in Joule happens by sending messages. There is no control flow. Instead, the programmer describes the flow of data, making it a dataflow programming language. It is considered the precursor to the E programming language. | https://en.wikipedia.org/wiki/Joule_(programming_language) |
| JAI | Jonathan Blow (born 1971) is an American video game designer and programmer, who is best known as the creator of the independent video games Braid (2008) and The Witness (2016), both of which were released to critical acclaim. From 2001 to 2004, Blow wrote the Inner Product column for Game Developer Magazine. He was the primary host of the Experimental Gameplay Workshop each March at the Game Developers Conference, which has become a premier showcase for new ideas in video games. In addition, Blow was a regular participant in the Indie Game Jam. Blow is also a founding partner of the Indie Fund, an angel investor fund for independent game projects. | https://en.wikipedia.org/wiki/JAI_(programming_language) |
| Jolie | Jolie (Java Orchestration Language Interpreter Engine) is an open-source programming language for developing distributed applications based on microservices. In the programming paradigm proposed with Jolie, each program is a service that can communicate with other programs by sending and receiving messages over a network. Jolie supports an abstraction layer that allows services to communicate using different mediums, ranging from TCP/IP sockets to local in-memory communications between processes.Jolie is currently supported by an interpreter implemented in the Java language, which can be run in multiple operating systems including Linux-based operating systems, OS X, and Windows. The language comes with formal semantics, meaning that the execution of Jolie programs is mathematically defined. For this reason, Jolie is used in research for the investigation of language-based techniques for the development of distributed systems, and it is also used for teaching at some Universities.The Jolie open source project was started by Fabrizio Montesi in 2006, as part of his studies at the University of Bologna. The project initially began as an implementation of the SOCK process calculus, a formal model proposed by Claudio Guidi et al. at the University of Bologna inspired by the CCS process calculus and the WS-BPEL programming language. Jolie extends SOCK with support for, e.g., tree-like data structures (inspired by XML, but with a syntax resembling that of C and Java), message types, typed session programming, integration with Java and JavaScript, code mobility, application containment, and web programming. A complete list of the project contributors is available at.The project is currently maintained by Fabrizio Montesi and its evolution is driven by Fabrizio Montesi and Claudio Guidi. Since it supports the orchestration of web services, Jolie is an alternative to XML-based orchestration languages such as WS-BPEL as it offers a concise (C-like) syntax for accessing XML-like data structures. | https://en.wikipedia.org/wiki/Jolie_(programming_language) |
| Join Java | Join Java is a programming language based on the join-pattern that extends the standard Java programming language with the join semantics of the join-calculus. It was written at the University of South Australia within the Reconfigurable Computing Lab by Dr. Von Itzstein. | https://en.wikipedia.org/wiki/Join_Java |
| Joe-E | Joe-E is a subset of the Java programming language intended to support programming according to object-capability discipline.The language is notable for being an early object-capability subset language. It has influenced later subset languages, such as ADsafe and Caja/Cajita, subsets of Javascript. It is also notable for allowing methods to be verified as functionally pure, based on their method signatures.The restrictions imposed by the Joe-E verifier include: Classes may not have mutable static fields, because these create global state. Catching out-of-memory exceptions is prohibited, because doing so allows non-deterministic execution. For the same reason, finally clauses are not allowed. Methods in the standard library may be blocked if they are deemed unsafe according to taming rules. For example, the constructor new File(filename) is blocked because it allows unrestricted access to the filesystem.Cup of Joe is slang for coffee, and so serves as a trademark-avoiding reference to Java. Thus, the name Joe-E is intended to suggest an adaptation of ideas from the E programming language to create a variant of the Java language. Waterken Server is written in Joe-E. | https://en.wikipedia.org/wiki/Joe-E |
| JCL | Job Control Language (JCL) is a name for scripting languages used on IBM mainframe operating systems to instruct the system on how to run a batch job or start a subsystem. More specifically, the purpose of JCL is to say which programs to run, using which files or devices for input or output, and at times to also indicate under what conditions to skip a step. There are two distinct IBM Job Control languages: one for the operating system lineage that begins with DOS/360 and whose latest member is z/VSE; and the other for the lineage from OS/360 to z/OS, the latter now including JES extensions, Job Entry Control Language (JECL). They share some basic syntax rules and a few basic concepts, but are otherwise very different. | https://en.wikipedia.org/wiki/Job_Control_Language |
| Jinja | Jinja is a template engine for the Python programming language and is licensed under a BSD License created by Armin Ronacher. It is similar to the Django template engine but provides Python-like expressions while ensuring that the templates are evaluated in a sandbox. It is a text-based template language and thus can be used to generate any markup as well as sourcecode. The Jinja template engine allows customization of tags, filters, tests, and globals. Also, unlike the Django template engine, Jinja allows the template designer to call functions with arguments on objects. Jinja is Flask's default template engine. | https://en.wikipedia.org/wiki/Jinja_(template_engine) |
| MPS | JetBrains MPS is a metaprogramming system which is being developed by JetBrains. MPS is a tool to design Domain-specific languages (DSL). It uses projectional editing which allows users to overcome the limits of language parsers, and build DSL editors, such as ones with tables and diagrams. It implements language-oriented programming. MPS is an environment for language definition, a language workbench, and integrated development environment (IDE) for such languages. | https://en.wikipedia.org/wiki/JetBrains_MPS |
| JSP | JavaServer Pages (JSP) is a technology that helps software developers create dynamically generated web pages based on HTML, XML, or other document types. Released in 1999 by Sun Microsystems, JSP is similar to PHP and ASP, but it uses the Java programming language. To deploy and run JavaServer Pages, a compatible web server with a servlet container, such as Apache Tomcat or Jetty, is required. | https://en.wikipedia.org/wiki/JavaServer_Pages |
| JavaScript | JavaScript (), often abbreviated as JS, is a high-level, dynamic, weakly typed, prototype-based, multi-paradigm, and interpreted programming language. Alongside HTML and CSS, JavaScript is one of the three core technologies of World Wide Web content production. It is used to make webpages interactive and provide online programs, including video games. The majority of websites employ it, and all modern web browsers support it without the need for plug-ins by means of a built-in JavaScript engine. Each of the many JavaScript engines represent a different implementation of JavaScript, all based on the ECMAScript specification, with some engines not supporting the spec fully, and with many engines supporting additional features beyond ECMA. As a multi-paradigm language, JavaScript supports event-driven, functional, and imperative (including object-oriented and prototype-based) programming styles. It has an API for working with text, arrays, dates, regular expressions, and basic manipulation of the DOM, but the language itself does not include any I/O, such as networking, storage, or graphics facilities, relying for these upon the host environment in which it is embedded. Initially only implemented client-side in web browsers, JavaScript engines are now embedded in many other types of host software, including server-side in web servers and databases, and in non-web programs such as word processors and PDF software, and in runtime environments that make JavaScript available for writing mobile and desktop applications, including desktop widgets. Although there are strong outward similarities between JavaScript and Java, including language name, syntax, and respective standard libraries, the two languages are distinct and differ greatly in design; JavaScript was influenced by programming languages such as Self and Scheme. | https://en.wikipedia.org/wiki/JavaScript |
| JavaFX Script | JavaFX Script is a scripting language designed by Sun Microsystems, forming part of the JavaFX family of technologies on the Java Platform. JavaFX targets the Rich Internet Application domain (competing with Adobe Flex and Microsoft Silverlight), specializing in rapid development of visually rich applications for the desktop and mobile markets. JavaFX Script works with integrated development environments such as NetBeans, Eclipse and IntelliJ IDEA. JavaFX is released under the GNU General Public License, via the Sun sponsored OpenJFX project. | https://en.wikipedia.org/wiki/JavaFX_Script |
| JavaCC | JavaCC (Java Compiler Compiler) is an open source parser generator and lexical analyzer generator written in the Java programming language. JavaCC is similar to yacc in that it generates a parser from a formal grammar written in EBNF notation. Unlike yacc, however, JavaCC generates top-down parsers. JavaCC can resolve choices based on the next k input tokens, and so can handle LL(k) grammars automatically; by use of "lookahead specifications", it can also resolve choices requiring unbounded look ahead. JavaCC also generates lexical analyzers in a fashion similar to lex. The tree builder that accompanies it, JJTree, constructs its trees from the bottom up. JavaCC is licensed under a BSD license. | https://en.wikipedia.org/wiki/JavaCC |
| Java | Java is a general-purpose computer programming language that is concurrent, class-based, object-oriented, and specifically designed to have as few implementation dependencies as possible. It is intended to let application developers "write once, run anywhere" (WORA), meaning that compiled Java code can run on all platforms that support Java without the need for recompilation. Java applications are typically compiled to bytecode that can run on any Java virtual machine (JVM) regardless of computer architecture. As of 2016, Java is one of the most popular programming languages in use, particularly for client-server web applications, with a reported 9 million developers. Java was originally developed by James Gosling at Sun Microsystems (which has since been acquired by Oracle Corporation) and released in 1995 as a core component of Sun Microsystems' Java platform. The language derives much of its syntax from C and C++, but it has fewer low-level facilities than either of them. The original and reference implementation Java compilers, virtual machines, and class libraries were originally released by Sun under proprietary licenses. As of May 2007, in compliance with the specifications of the Java Community Process, Sun relicensed most of its Java technologies under the GNU General Public License. Others have also developed alternative implementations of these Sun technologies, such as the GNU Compiler for Java (bytecode compiler), GNU Classpath (standard libraries), and IcedTea-Web (browser plugin for applets). The latest version is Java 9, released on September 21, 2017, and is one of the two versions currently supported for free by Oracle. Versions earlier than Java 8 are supported by companies on a commercial basis; e.g. by Oracle back to Java 6 as of October 2017 (while they still "highly recommend that you uninstall" pre-Java 8 from at least Windows computers). | https://en.wikipedia.org/wiki/Java_(programming_language) |
| Java Bytecode | Java bytecode is the instruction set of the Java virtual machine (JVM). | https://en.wikipedia.org/wiki/Java_bytecode |
| JSML | Java Speech API Markup Language (JSML) is an XML-based markup language for annotating text input to speech synthesizers. JSML is used within the Java Speech API. JSML is an XML application and conforms to the requirements of well-formed XML documents. Java Speech API Markup Language is referred to as JSpeech Markup Language when describing the W3C documentation of the standard. Java Speech API Markup Language and JSpeech Markup Language identical apart from the change in name, which is made to protect Sun trademarks. JSML is primarily an XML text format used by Java applications to annotate text input to speech synthesizers. Elements of JSML provide speech synthesizer with detailed information on how to speak text in a naturalized fashion. JSML defines elements which define a document's structure, the pronunciation of certain words and phrases, features of speech such as emphasis and intonation, etc. JSML is designed in the Java fashion to be simple to learn and use, to be portable across different synthesizers and computing platforms, and although designed for use within is also applicable to a wide range of languages. An example of how JSML is defined is set out below: The W3C has developed a standard markup language called SSML, which is based on JSML but is not identical to it. This became a formal W3C recommendation in 2004. | https://en.wikipedia.org/wiki/Java_Speech_Markup_Language |
| Java EE version history | Java Platform, Enterprise Edition (Java EE), formerly Java 2 Platform, Enterprise Edition (J2EE), currently Jakarta EE, is a set of specifications, extending Java SE 8 (i.e. not based on latest Java 11; while can also work with later it or later than Java 8) with specifications for enterprise features such as distributed computing and web services. Java EE applications are run on reference runtimes, that can be microservices or application servers, which handle transactions, security, scalability, concurrency and management of the components it is deploying. Java EE is defined by its specification. The specification defines APIs and their interactions. As with other Java Community Process specifications, providers must meet certain conformance requirements in order to declare their products as Java EE compliant. Examples of contexts in which Java EE referencing runtimes are used are: e-commerce, accounting, banking information systems. | https://en.wikipedia.org/wiki/Java_EE_version_history |
| Jargon | Jargon is a type of language that is used in a particular context and may not be well understood outside that context. The context is usually a particular occupation (that is, a certain trade, profession, or academic field), but any in group can have jargon. The main trait that distinguishes jargon from the rest of a language is special vocabulary—including some words specific to it, and often different senses or meanings of words, that out groups would tend to take in another sense—therefore misunderstanding that communication attempt. Jargon is thus "the technical terminology or characteristic idiom of a special activity or group". Most jargon is technical terminology, involving terms of art or industry terms, with particular meaning within a specific industry. A main driving force in the creation of technical jargon is precision and efficiency of communication when a discussion must easily range from general themes to specific, finely differentiated details without circumlocution. A side-effect of this is a higher threshold for comprehensibility, which is usually accepted as a trade-off but is sometimes even used as a means of social exclusion (reinforcing ingroup-outgroup barriers) or social aspiration (when intended as a way of showing off). The philosopher Étienne Bonnot de Condillac observed in 1782 that "every science requires a special language because every science has its own ideas". As a rationalist member of the Enlightenment, he continued: "It seems that one ought to begin by composing this language, but people begin by speaking and writing, and the language remains to be composed."Various kinds of language peculiar to ingroups can be named across a semantic field. Slang can be either culture-wide or known only within a certain group or subculture. Argot is slang or jargon purposely used to obscure meaning to outsiders. Conversely, a lingua franca is used for the opposite effect, helping communicators to overcome unintelligibility, as are pidgins and creole languages. For example, the Chinook Jargon was a pidgin. Although technical jargon's primary purpose is to aid technical communication, not to exclude outsiders by serving as an argot, it can have both effects at once and can provide a technical ingroup with shibboleths. For example, medieval guilds could use this as one means of informal protectionism. On the other hand, jargon that once was obscure outside a small ingroup can become generally known over time. For example, the terms bit, byte, and hexadecimal (which are terms from computing jargon) are now recognized by many people outside computer science. | https://en.wikipedia.org/wiki/Jargon |
| Janus | Janus is the two-faced Roman god of gates, doors, doorways, beginnings, and endings. Janus may also refer to: | https://en.wikipedia.org/wiki/Janus_(concurrent_constraint_programming_language) |
| Janus | Janus is a time-reversible programming language written at Caltech in 1982. The operational semantics of the language were formally specified, together with a program inverter and an invertible self-interpreter, in 2007 by Tetsuo Yokoyama and Robert Glück. A Janus inverter and interpreter is made freely available by the TOPPS research group at DIKU. Another Janus interpreter was implemented in Prolog in 2009. The below summarises the language presented in the 2007 paper. Janus is an imperative programming language with a global store (there is no stack or heap allocation). Janus is a reversible programming language, i.e. it supports deterministic forward and backward computation by local inversion. | https://en.wikipedia.org/wiki/Janus_(time-reversible_computing_programming_language) |
| JScript | JScript is Microsoft's dialect of the ECMAScript standard that is used in Microsoft's Internet Explorer. JScript is implemented as an Active Scripting engine. This means that it can be "plugged in" to OLE Automation applications that support Active Scripting, such as Internet Explorer, Active Server Pages, and Windows Script Host. It also means such applications can use multiple Active Scripting languages, e.g., JScript, VBScript or PerlScript. JScript was first supported in the Internet Explorer 3.0 browser released in August 1996. Its most recent version is JScript 9.0, included in Internet Explorer 9. JScript 10.0 is a separate dialect, also known as JScript .NET, which adds several new features from the abandoned fourth edition of the ECMAScript standard. It must be compiled for .NET Framework version 2 or version 4, but static type annotations are optional. | https://en.wikipedia.org/wiki/JScript |
| JSONiq | JSONiq is a query and functional programming language that is designed to declaratively query and transform collections of hierarchical and heterogeneous data in format of JSON, XML, as well as unstructured, textual data. JSONiq is an open specification published under the Creative Commons Attribution-ShareAlike 3.0 license. It is based on the XQuery language, with which it shares the same core expressions and operations on atomic types. JSONiq comes in two syntactical flavors, which both support JSON and XML natively. The JSONiq syntax (a superset of JSON) extended with XML support through a compatible subset of XQuery. The XQuery syntax (native XML support) extended with JSON support through a compatible subset (the JSONiq extension to XQuery) of the above JSONiq syntax. | https://en.wikipedia.org/wiki/JSONiq |
| JSON-LD | JSON-LD (JavaScript Object Notation for Linked Data), is a method of encoding Linked Data using JSON. It was a goal to require as little effort as possible from developers to transform their existing JSON to JSON-LD. This allows data to be serialized in a way that is similar to traditional JSON. It is a World Wide Web Consortium Recommendation. It was initially developed by the JSON for Linking Data Community Group before being transferred to the RDF Working Group for review, improvement, and standardization. | https://en.wikipedia.org/wiki/JSON-LD |
| JRuby | JRuby is an implementation of the Ruby programming language atop the Java Virtual Machine, written largely in Java. It is free software released under a three-way EPL/GPL/LGPL license. JRuby is tightly integrated with Java to allow the embedding of the interpreter into any Java application with full two-way access between the Java and the Ruby code (similar to Jython for the Python language). JRuby's lead developers are Charles Oliver Nutter and Thomas Enebo, with many current and past contributors including Ola Bini and Nick Sieger. In September 2006, Sun Microsystems hired Enebo and Nutter to work on JRuby full-time. In June 2007, ThoughtWorks hired Ola Bini to work on Ruby and JRuby.In July 2009, the JRuby developers left Sun to continue JRuby development at Engine Yard. In May 2012, Nutter and Enebo left Engine Yard to work on JRuby at Red Hat. | https://en.wikipedia.org/wiki/JRuby |
| JOVIAL | JOVIAL is a high-level computer programming language similar to ALGOL, but specialized for the development of embedded systems (specialized computer systems designed to perform one or a few dedicated functions, usually embedded as part of a complete device including mechanical parts). | https://en.wikipedia.org/wiki/JOVIAL |
| JOSS | JOSS (an acronym for JOHNNIAC Open Shop System) was one of the very first interactive, time-sharing programming languages. JOSS I, developed by J. Clifford Shaw at RAND was first implemented, in beta form, on the JOHNNIAC computer in May 1963. The full implementation was deployed in January 1964, supporting five terminals and the final version, supporting ten terminals, was deployed in January 1965.JOSS was written in a symbolic assembly language called EasyFox (E and F in the US military's phonetic alphabet of that time). EasyFox was also developed by Cliff Shaw. JOSS was dubbed "The Helpful Assistant" for its conversational user interface. Originally green/black typewriter ribbons were used in its terminals with green being used for user input and black for the computer's response. Mathematically, JOSS was interesting because it stored all numbers as an integer and a decimal exponent. This means calculations were exact decimal values, as opposed to floating point calculations. One third plus one third plus one third was exactly one. Any command that was not understood elicited the response "Eh?" or "SORRY". JOSS II, was developed by Charles L. Baker, Joseph W. Smith, Irwin D. Greenwald, and G. Edward Bryan for the PDP-6 computer between 1964 and February 1966. Many variants of JOSS were developed and implemented on a variety of platforms. Some of these variants remained very similar to the original: TELCOMP, FOCAL, CAL, CITRAN, ISIS, PIL/I, JEAN (ICT 1900 series), AID (PDP-10); while others, such as MUMPS, developed in distinctive directions. | https://en.wikipedia.org/wiki/JOSS |
| JMP | JMP (pronounced "jump") is a suite of computer programs for statistical analysis developed by the JMP business unit of SAS Institute. It was launched in 1989 to take advantage of the graphical user interface introduced by the Macintosh. It has since been significantly rewritten and made available for the Windows operating system. JMP is used in applications such as Six Sigma, quality control, and engineering, design of experiments, as well as for research in science, engineering, and social sciences. The software can be purchased in any of five configurations: JMP, JMP Pro, JMP Clinical, JMP Genomics and the JMP Graph Builder App for the iPad. JMP can be automated with its proprietary scripting language, JSL. The software is focused on exploratory visual analytics, where users investigate and explore data. These explorations can also be verified by hypothesis testing, data mining, or other analytic methods. In addition, discoveries made through graphical exploration can lead to a designed experiment that can be both designed and analyzed with JMP. | https://en.wikipedia.org/wiki/JMP_(statistical_software) |
| JIS X 0201 | JIS X 0201, a Japanese Industrial Standard developed in 1969 (then called JIS C 6220 until the JIS category reform), was the first Japanese electronic character set to become widely used. It is either 7-bit encoding or 8-bit encoding, although 8-bit encoding is dominant for modern use. The full name of this standard is 7-bit and 8-bit coded character sets for information interchange (7ビット及び8ビットの情報交換用符号化文字集合). The first 96 codes comprise an ISO 646 variant, mostly following ASCII with some differences, while the second 96 character codes represent the phonetic Japanese katakana signs. Since the encoding does not provide any way to express hiragana or kanji, it is only capable of expressing simplified written Japanese. Nevertheless, it is possible to express, at least phonetically, the full range of sounds in the language. In the 1980s, this was acceptable for media such as text mode computer terminals, telegrams, receipts or other electronically handled data. JIS X 0201 was supplanted by subsequent encodings such as Shift JIS (which combines this standard and JIS X 0208) and later Unicode. | https://en.wikipedia.org/wiki/JIS_X_0201 |
| JOSS Extended and Adapted for Nineteen-hundred | JEAN was a dialect of the JOSS programming language developed for and used on ICT 1900 series computers in the late 1960s and early 1970s; it was implemented under the MINIMOP operating system. It was used at the University of Southampton. JEAN was an acronym derived from "JOSS Extended and Adapted for Nineteen-hundred". It was operated from a Teletype terminal. | https://en.wikipedia.org/wiki/JEAN |
| JAWS Scripting Language | JAWS Scripting Language is a proprietary programming language that facilitates the interoperability of the JAWS for Windows screen reading program with practically any application–both proprietary and off-the-shelf. The JAWS Scripting Language, or JSL is a compiled language, allowing for source code protection. "JAWS scripting" commonly also cumulatively refers to customization of JAWS through use of its built-in, user-editable utilities (called "Managers") or editing the configuration files directly, in combination with writing actual scripts. The scripting language is an API that exposes functionality including a combination of traditional JAWS scripting, MSAA Server direct scripting, and document object model scripting to ensure optimal performance of JAWS to end-users. | https://en.wikipedia.org/wiki/JAWS_Scripting_Language |
| Just Another Scripting Syntax | JASS and JASS2 (sometimes said to stand for Just Another Scripting Syntax) is a scripting language provided with an event-driven API created by Blizzard Entertainment. It is used extensively by their games Warcraft III (JASS2) and StarCraft (JASS) for scripting events in the game world. Map creators can use it in the Warcraft III World Editor and the Starcraft Editor to create scripts for triggers and AI (artificial intelligence) in custom maps and campaigns. Blizzard Entertainment has replaced JASS with Galaxy in Starcraft II. | https://en.wikipedia.org/wiki/JASS |
| JAL compiler | JAL (Just Another Language) is a Pascal-like programming language and compiler that generates executable code for PIC microcontrollers. It is a free-format language with a compiler that runs on Linux, MS-Windows and MS-DOS (OSX support). It is configurable and extendable through the use of libraries and can even be combined with PIC assembly language. | https://en.wikipedia.org/wiki/JAL_(compiler) |
| JADE | JADE is a proprietary object-oriented software development and deployment platform product from the New Zealand-based Jade Software Corporation, first released in 1996. It consists of the JADE programming language, IDE and debugger, integrated application server and object database management system. Designed as an end-to-end development environment to allow systems to be coded in one language from the database server down to the clients, it also provides APIs for other languages, including .NET Framework, Java, C/C++ and Web services. Although a free limited licence is available for development, using the JADE platform requires per-process fees to be paid. | https://en.wikipedia.org/wiki/JADE_(programming_language) |
| Irvine Dataflow | Irvine Dataflow (Id) is a general-purpose parallel programming language, started at the University of California at Irvine in 1975 by Arvind and K. P. Gostelow. Arvind continued work with Id at MIT into the 1990s. The major subset of Id is a purely functional programming language with non-strict semantics. Features include: higher-order functions, a Milner-style statically type-checked polymorphic type system with overloading, user defined types and pattern matching, and prefix and infix operators. It led to the development of pH, a parallel dialect of Haskell. Id programs are fine grained implicitly parallel. The MVar synchronisation variable abstraction in Haskell is based on Id's M-structures. | https://en.wikipedia.org/wiki/Id_(programming_language) |
| IPTSCRAE | Iptscrae is a stack-oriented scripting language used to give additional functionality to The Palace software and servers. Its name comes from the pronunciation of "script" in Pig Latin. [1] The language was created by Jim Bumgardner, who in turn was inspired by Forth, another stack-based language. Bumgardner chose this style of language because it is extremely easily to implement an interpreter, since there is no need to support parenthetical groupings or operator precedence. The name "iptScrae" was borrowed by Bumgardner from a former colleague and mentor, Kevin Bjorke, who came up with the name "iptscray" for a freeware Forth interpreter a few years previously. Bumgardner originally created Iptscrae for Idaho, an in-house multi-media authoring system, similar to HyperCard, which he created while an employee at Warner New Media. He then reused and modified the IptScrae compiler for the Palace project, which was developed in 1994. Although it is a scripting language, many have used it to provide additional functionality to many other programs and functions. Forums can be created with Iptscrae while embedding it with JavaScript, as many factions of Iptscrae fans have done in the past. It's fully possible to implement Iptscrae with other languages, even if they're not on the same dynamic principles. For example, Iptscrae has, in the past, been webbed together with Java, JavaScript, HTML, and other artificial languages, including other scripting languages, programming languages, specification languages, query languages, and markup languages to add more end-user interactions and commands to other programs, without sacrificing user-friendliness. In the past years, Iptscrae has even been utilized in computer peer groups through open-source language compilers, using not only transformation and hardware description languages, but also combining it with several other genres of computer languages to create an intertwined web of user-friendliness and application compatibility. | https://en.wikipedia.org/wiki/IPTSCRAE |
| Ioke | Ioke is a dynamic, strongly typed, prototype-based programming language targeting the Java Virtual Machine and the Common Language Runtime. It was designed by Ola Bini, a developer of JRuby. It has a very simple homoiconic syntax, somewhat similar to Io. | https://en.wikipedia.org/wiki/Ioke_(programming_language) |
| Io | Io is a pure object-oriented programming language inspired by Smalltalk, Self, Lua, Lisp, Act1, and NewtonScript. Io has a prototype-based object model similar to the ones in Self and NewtonScript, eliminating the distinction between instance and class. Like Smalltalk, everything is an object and it uses dynamic typing. Like Lisp, programs are just data trees. Io uses actors for concurrency. Remarkable features of Io are its minimal size and openness to using external code resources. Io is executed by a small, portable virtual machine. | https://en.wikipedia.org/wiki/Io_(programming_language) |
| Interlisp | Interlisp (also seen with a variety of capitalizations) is a programming environment built around a version of the Lisp programming language. Interlisp development began in 1966 at Bolt, Beranek and Newman in Cambridge, Massachusetts with Lisp implemented for the DEC PDP-1 by Danny Bobrow and D. L. Murphy. In 1970 BBN LISP was designed, which ran on PDP-10 machines running the TENEX operating system. In 1973, when Danny Bobrow, Warren Teitelman and Ronald Kaplan moved from BBN to Xerox PARC, it was renamed Interlisp. Interlisp became a popular Lisp development tool for AI researchers at Stanford University and elsewhere in the DARPA community. Interlisp was notable for the integration of interactive development tools into the environment, such as a debugger, an automatic correction tool for simple errors (DWIM – "do what I mean"), and analysis tools. | https://en.wikipedia.org/wiki/Interlisp |
| ILBM | Interleaved Bitmap (ILBM) is an image file format conforming to the Interchange File Format (IFF) standard. The format originated on the Amiga platform, and on IBM-compatible systems, files in this format or the related PBM (Planar Bitmap) format are typically encountered in games from late 1980s and early 1990s that were either Amiga ports or had their graphical assets designed on Amiga machines.A characteristic feature of the format is that it stores bitmaps in the form of interleaved bit planes, which gives the format its name; this reflects the way the Amiga graphics hardware natively reads graphics data from memory. A simple form of compression is supported to make ILBM files more compact.On the Amiga, these files are not associated with a particular file extension, though as they started being used on PC systems where extensions are systematically used, they employed a .lbm or occasionally a .bbm extension. | https://en.wikipedia.org/wiki/ILBM |
| Interchange File Format | Interchange File Format (IFF), is a generic container file format originally introduced by the Electronic Arts company in 1985 (in cooperation with Commodore) in order to facilitate transfer of data between software produced by different companies. IFF files do not have any standard extension. On many systems that generate IFF files, file extensions are not important (the OS stores file format metadata separately from the file name). An .iff extension is commonly used for ILBM format files, which use the IFF container format. Resource Interchange File Format is a format developed by Microsoft and IBM in 1991 that is based on IFF, except the byte order has been changed to little-endian to match the x86 processor architecture. Apple's AIFF is a big-endian audio file format developed from IFF. The TIFF image file format is unrelated. | https://en.wikipedia.org/wiki/Interchange_File_Format |
| Integer BASIC | Integer BASIC, written by Steve Wozniak, is the BASIC interpreter of the Apple I and original Apple II computers. Originally available on cassette, then included in ROM on the original Apple II computer at release in 1977, it was the first version of BASIC used by many early home computer owners.Integer BASIC was phased out in favor of Applesoft BASIC starting with the Apple II Plus in 1979. This was a licensed but modified version of Microsoft BASIC, which included the floating point support missing in Integer BASIC. | https://en.wikipedia.org/wiki/Integer_BASIC |
| Apple BASIC | Integer BASIC, written by Steve Wozniak, is the BASIC interpreter of the Apple I and original Apple II computers. Originally available on cassette, then included in ROM on the original Apple II computer at release in 1977, it was the first version of BASIC used by many early home computer owners.Integer BASIC was phased out in favor of Applesoft BASIC starting with the Apple II Plus in 1979. This was a licensed but modified version of Microsoft BASIC, which included the floating point support missing in Integer BASIC. | https://en.wikipedia.org/wiki/Apple_BASIC |
| Instruction list | Instruction List (IL) is one of the 5 languages supported by the IEC 61131-3 standard. It is designed for programmable logic controllers (PLCs). It is a low level language and resembles assembly. All of the languages share IEC61131 Common Elements. The variables and function call are defined by the common elements so different languages can be used in the same program. Program control (control flow) is achieved by jump instructions and function calls (subroutines with optional parameters). The file format has now been standardized to XML by PLCopen. | https://en.wikipedia.org/wiki/Instruction_list |
| Inno Setup | Inno Setup is a free software script-driven installation system created in Delphi by Jordan Russell. The first version was released in 1997. | https://en.wikipedia.org/wiki/Inno_Setup |
| IBM Informix-4GL | Informix-4GL is a 4GL programming language developed by Informix during the mid-1980s. | https://en.wikipedia.org/wiki/IBM_Informix-4GL |
| Information Processing Language | Information Processing Language (IPL) is a programming language created by Allen Newell, Cliff Shaw, and Herbert A. Simon at RAND Corporation and the Carnegie Institute of Technology at about 1956. Newell had the job of language specifier-application programmer, Shaw was the system programmer, and Simon took the job of application programmer-user. The language includes features intended to help with programs that perform simple problem solving actions such as lists, dynamic memory allocation, data types, recursion, functions as arguments, generators, and cooperative multitasking. IPL invented the concept of list processing, albeit in an assembly-language style. | https://en.wikipedia.org/wiki/Information_Processing_Language |
| Information Presentation Facility | Information Presentation Facility (IPF) is a system for presenting online help and hypertext on IBM OS/2 systems. IPF also refers to the markup language that is used to create IPF content. The IPF language has its origins in BookMaster and Generalized Markup Language developed by IBM. The IPF language is very similar to the well-known HTML language, version 3.0, with a range |