Questions Columns Rows
GitHub icon

Formatted Table

Formatted Table - Data notation

< >

Formatted Table is a data notation created in 1990.

#1243on PLDB 33Years Old 0Repos

A simple plain text format for storing tabular data.


Example from the web:
Weekly SST data starts week centered on 3Jan1990 Nino1+2 Nino3 Nino34 Nino4 Week SST SSTA SST SSTA SST SSTA SST SSTA 03JAN1990 23.4-0.4 25.1-0.3 26.6 0.0 28.6 0.3 10JAN1990 23.4-0.8 25.2-0.3 26.6 0.1 28.6 0.3 17JAN1990 24.2-0.3 25.3-0.3 26.5-0.1 28.6 0.3 24JAN1990 24.4-0.5 25.5-0.4 26.5-0.1 28.4 0.2
Example from the web:
ACCEPTABLE LEFT PRIMERS 1-based # self self hair- qual- # sequence start ln N GC% Tm any_th end_th pin lity 0 tgctagctaggcgatgctag 411 20 0 55.00 60.028 23.16 23.16 38.59 0.028 1 actgatacgcgatgctagct 476 20 0 50.00 59.957 17.69 1.35 0.00 0.043 2 gatcgatgctagctaggcga 405 20 0 55.00 60.100 16.30 16.30 0.00 0.100 3 tcgatcgatgctagctaggc 403 20 0 55.00 60.100 18.63 8.45 0.00 0.100 4 tagctgatcgatcgtagcgg 565 20 0 55.00 60.101 25.02 17.36 0.00 0.101 5 gctgactgatcgatcgatgc 113 20 0 55.00 59.826 24.08 17.09 35.21 0.174 6 tatcatctctgcgcgatcga 361 20 0 50.00 59.747 22.07 1.72 38.48 0.253 7 agctaggcgatgctagctag 415 20 0 55.00 59.742 17.46 17.46 41.54 0.258 8 ctagctaggcgatgctagct 413 20 0 55.00 59.742 18.68 17.35 43.53 0.258 9 ggcgatctagctagctgact 583 20 0 55.00 59.671 17.44 7.44 37.58 0.329 10 tcgatgctagctaggcgatg 407 20 0 55.00 60.382 14.03 0.00 0.00 0.382 11 gctgatcgatcgatgctagc 398 20 0 55.00 59.618 25.97 24.79 35.21 0.382 12 gctagctgatcgatcgatgc 394 20 0 55.00 59.618 24.08 21.09 35.21 0.382 13 atcatctctgcgcgatcgat 362 20 0 50.00 60.382 22.07 5.02 38.48 0.382 14 gactgatacgcgatgctagc 475 20 0 55.00 59.551 8.61 8.61 0.00 0.449 15 atcgatgctagctaggcgat 406 20 0 50.00 59.452 18.43 18.43 0.00 0.548 16 gctagctgactgatacgcga 468 20 0 55.00 60.589 16.29 0.00 0.00 0.589 17 agctagctgactgatacgcg 467 20 0 55.00 60.590 17.99 3.89 0.00 0.590 18 atgctagctaggcgatgcta 410 20 0 50.00 59.375 10.59 8.91 0.00 0.625 19 ctatcatctctgcgcgatcg 360 20 0 55.00 59.347 12.19 12.19 39.07 0.653 20 gatgctagctaggcgatgct 409 20 0 55.00 60.668 7.01 7.53 0.00

View source

- Build the next great programming language Search Add Language Features Creators Resources About Blog Acknowledgements Stats Sponsor Traffic Traffic Today Day 279 feedback@pldb.com Logout